Продажа квадроциклов, снегоходов и мототехники
second logo
Пн-Чт: 10:00-20:00
Пт-Сб: 10:00-19:00 Вс: выходной

+7 (812) 924 3 942

+7 (911) 924 3 942

Содержание

32600р. + подарок или скидка — Штатная магнитола для Lada Xray 2016+

Экран,
сенсор
9″ дюймов экран Ёмкостный морозостойкий сенсор, мультитач до 5 касаний (например масштабирование и вращение карты 2-мя пальцами), отзывчивое и легкое касание — так же, как на современных смартфонах и планшетах
Операционная
система
Android 10 интерфейс разработан специально для использования в автомобиле, на Русском языке. Пользоваться навигацией и устанавливать приложения с Google Play Market так же просто, как и на обычном смартфоне или планшете
Процессор Процессор Mediatek MTK8259 — 75K баллов быстродействия по тесту Antutu 8. Полная загрузка ~25 сек., а из режима сна — мгновенно!
Память Оперативная память: 4 ГБ
Внутренняя память: 64 ГБ
Поддержка USB флешек и внешних USB жестких дисков до 2000ГБ
(некоторым моделям HDD может требоваться доп. питание)
ТВ Поддержка цифрового онлайн ТВ через приложения Android , везде где доступен интернет и на любой скорости автомобиля!
FM-Радио FM-радио чип TEF6686 с поддержкой RDS

Поддержка онлайн-радио: тысячи радиостанций с музыкой на любой вкус, в цифровом качестве — чистый звук и без рекламы! Любимая радиостанция будет работать везде, где ловит 4G или хотя бы 3G интернет

Навигация GPS приемник. Точность координат до 3 метров, антенна в комплекте.
Поддержка навигации с пробками, голосовым набором маршрута и онлайн обновляемыми картами. С Google Play Market можно легко установить: Яндекс Навигатор (бесплатно), карты Google (бесплатно), Навител, Ситигид, Прогород и др. Возможность работы в фоновом режиме нескольких навигационных программ и музыки/видео одновременно!
Музыка
ОНЛАЙН РАДИО, МУЗЫКА : поддержка форматов MP3, WMA, WAW, AAC, AC3, OGG, FLAC, MKA (LOSELESS) и многих других.
Видео ОНЛАЙН ТВ, ВИДЕО: Full HD 1080p любых форматов: AVI (DivX, Xvid, Mpeg4, h.264), MKV, WMV, FLV, WebM и другие (рекомендуем бесплатный «MX видео плеер»)
3G/4G (LTE)
интернет
Встроенный модем 3G/4G(LTE)! Поддерживаются сим карты любых Российских операторов связи.
Поддержка точки доступа WiFi со смартфона, или 3G/4G+WiFi роутеров Мегафон, МТС, Билайн, Tele2, Yota и др.
4G-WiFi роутер (любая сим-карта), добавляйте в опциях
WIFI WIFI встроенный модуль
Возможность по WiFi принимать интернет с вашего смартфона (нужно включить на нем точку доступа WiFi) Поддержка режима «Точки доступа WiFi», т.е. можно раздавать 4G интернет с головного устройства пассажирам
USB разъемы USB2.0 OTG HOST разъем сзади. Длинные USB провода в комплекте (хватает до бардачка). Поддержка
USB жестких дисков до 1000ГБ
(некоторые HDD требуют доп. питания).
Громкая связь
Bluetooth
Встроенный модуль громкой связи (Bluetooth), для Hands-Free, русская телефонная книга с поиском. Встроенный + внешний микрофон в комплекте (разъем Mini-Jack 3,5мм) Беспроводное воспроизведение музыки с iPhone/iPad/iPod/Android по Bluetooth (A2DP).
Возможность совершать вызов как с SIM-карты магнитолы, так и с телефона, подключенного к магнитоле по Bluetooth.
OBD2
диагностика
Поддержка беспроводного OBD2 адаптера для: считывания ошибок, отображения датчиков двигателя, расхода топлива и другой бортовой информации. Адаптер добавляйте в опциях.
Штатные
функции
Поддерживается для XRay 2016+: кнопки мульти-руля, автоматическое включение и выключение от сигнала зажигания (ACC), и другие — уточняйте
Поддержка камеры заднего вида Автоматическое включение камеры на весь экран при движении задним ходом.
Отдельный видео-вход для камеры заднего вида (в дополнение к линейному видео-входу).
Добавляйте камеры в опциях.
Поддержка камеры переднего вида Подключение передней камеры через линейный видео-вход (уточняйте).
Включать видео-вход можно иконкой на главном экране (AUX) или назначить на кнопку магнитолы или руля (уточняйте).
ЗВУК и
аудио-разъемы
Самый лучший звук! По нашей оценке — 5 из 5 баллов! Благодаря встроенному DSP аудио-процессору с много-полосным эквалайзером, тонкомпенсацией, поканальными задержками, срезами частот и тд
Встроенный MOSFET аудио-усилитель — TDA7851
Комплектация
  1. Устройство поставляется в заводской OEM упаковке для установочных центров и автодиллеров, без указания бренда и модели на упаковке и самом головном устройстве. Данная упаковка была специально выбрана поставщиками Roximo для снижения конечной стоимости автомагнитолы для покупателей.
  2. Инструкции по установке обычно нет в комплекте. Это сделано для того чтобы покупатели стремились устанавливать у специалистов. Если требуется, мастер-установщик должен напрямую обратиться в техподдержку Roximo. Контакты указаны в гарантийном талоне, или можете их уточнить у нас в магазине

Сравнение Lexus RX и Lada Kalina. Что лучше?

Двигатель и трансмиссия

Количество цилиндров

6

Количество цилиндров

4

Клапанов на цилиндр

4

Клапанов на цилиндр

4

Расположение двигателя

Спереди, поперечно

Расположение двигателя

Спереди, поперечно

Расположение цилиндров

V-образное

Расположение цилиндров

Рядное

Количество передач (автоматическая трансмиссия)

8

Количество передач (автоматическая трансмиссия)

5

Производительность

Мощность двигателя

295 л.с. при 6300 об/мин

Мощность двигателя

106 л.с. при 5800 об/мин

Крутящий момент

362 Нм при 4700 об/мин

Крутящий момент

148 Нм при 4000 об/мин

Максимальная скорость

198 км/ч

Максимальная скорость

178 км/ч

Расход топлива

Расход топлива (смешанный режим)

10.2 л/100 км

Расход топлива (смешанный режим)

6.7 л/100 км

Расход топлива на трассе

8.4 л/100 км

Расход топлива на трассе

5.5 л/100 км

Расход топлива в городе

11.8 л/100 км

Расход топлива в городе

8.8 л/100 км

Объем топливного бака

73 л

Объем топливного бака

50 л

Подача топлива

Многоточечный впрыск

Подача топлива

Многоточечный впрыск

Вес и обьемы

Вместимость багажника со сложенными сидениями

453 л

Вместимость багажника со сложенными сидениями

355 л

Вместимость багажника с разложенными сидениями

924 л

Вместимость багажника с разложенными сидениями

670 л

Максимальная разрешенная масса

2567 кг

Максимальная разрешенная масса

1560 кг

Максимальная масса буксируемого прицепа с тормозами

1586 кг

Максимальная масса буксируемого прицепа с тормозами

900 кг

Количество мест

5

Количество мест

5

Другое

Габариты

Колесная база

2789 мм

Колесная база

2476 мм

Шасси и колеса

Размер шин

235/65 R18

Размер шин

195/55 R15

Колея передних колес

1636 мм

Колея передних колес

1430 мм

Колея задних колес

1625 мм

Колея задних колес

1418 мм

m853px 34 Лада 2111 — гос номер авто

Индивидуальный регистрационный знак (номер) автомобиля.

В России основная часть регистрационных знаков образца 1993 года, в соответствии с ГОСТ Р 50577-93. Отличия по формату и/или размеру от стандартных имеют: номерные знаки маршрутных ТС, военных ТС, ТС дипломатических миссий, ТС МВД, прицепов, строительной техники и мотоциклов.

Стандартные номера состоят из 3 букв и 3 цифр. Буквы означают серию номерного знака, а цифры — номер. Примером может послужить описание автомобильного номера на данной странице, М 853 РХ 34 По ГОСТу для использования разрешены 12 букв кириллицы, которыые имеют графические аналоги в латинском алфавите (А, В, Е, К, М, Н, О, Р, С, Т, У, Х). В правой части номерного знака, отделенной вертикальной черной линией, расположены: флаг Российской Федерации и надпись «RUS», в верхней кодовое обозначение субъекта РФ, где был зарегистрирован автомобиль.

Все используемые автомобильные номера зарегистрированы. Для каждого административного района определен свой номер, общий для всех ТС, зарегистрированных в этом округе. Общее количество комплектов регистрационных знаков, которое может быть изготовлено для каждого субъекта России, определяется ГОСТом и составляет 1726272 шт.

Изначально в качестве кодов регионов применялись только числа от 01 до 89, по количеству регионов РФ на 1 января 1993 года. Однако количество регистрируемых автомобилей с каждым годом увеличивается, и номерных знаков с допустимыми комбинациями стало недостаточно. По этой причине в ряде субъектов России вводятся дополнительные кодовые обозначения, которые можно использовать на знаках; сначала началась выдача кодов регионов из девятого десятка (9х) (кроме кода 92), а затем перешли к трёхзначным кодам регионов. Три и более кодов региона используют Москва (коды 77, 99, 97, 177, 199, 197, 777), Московская область (50, 90, 150, 190), Красноярский край (24, 84, 88, 124), Санкт-Петербург (78, 98, 178), Краснодарский край (23, 93, 123), Пермский край (59, 81, 159) и Свердловская область (66, 96, 196), при этом Краснодарский и Пермский края получили еще один код «в наследство» от вошедших в их состав других субъектов федерации, 19 субъектов используют два кода региона. На данной странице указан номер из субъекта РФ: Волгоградская область.

После введения ныне действующего ГОСТа номера предыдущих образцов не изымались, по этой причине до сих пор на дорогах России можно встретить автомобили с советскими номерными знаками: образца 1980 года — из четырех цифр и трёх букв на белом фоне, и даже образца 1958 года — из двух двузначных чисел, разделенных дефисом, и идущих за ними трёх букв на чёрном фоне. Желтые номера образца 1947 года очень редко встречаются, часто бутафорские на ретро-автомобилях. На нашем сайте основной частью регистрационных знаков являются номера частных транспортных средств (М 853 РХ 34). Для размещения информации о номере автомобиля обязательно требуется фото ТС, его Марка и Модель (Лада 2111).

RX 400h заставит вас коллекционировать кубики :: Autonews

Гордость японского производителя вызывает лишь улыбку у обычного водителя и уж тем более у создателей Белаза. Гигантский автомобиль обладает электромотором в каждом колесе, а бензиновый двигатель работает исключительно на генератор обеспечивающий их энергией. Но зачем ворошить историю. Вот оно — чудо автомобилестроения 21 века. Новые технологии во внедорожнике с гибридной силовой установкой под названием Lexus RX400h. О том, что продажи этого автомобиля начнутся на российском рынке, Toyota объявила еще прошлой осенью. Но согласитесь, о перспективах увидеть такие чудеса на российском рынке врядли кто-то задумывался всерьез. Вопросы вызывает как жизнеспособность этого автомобиля, так и его адаптация к суровым условиям нашей реальности.

Сердцем RX 400h является система Hybrid Synergy Drive (HSD). Ее основные компоненты — это передний и задний электромоторы и 6-цилиндровый V-образный бензиновый двигатель объемом 3,3 литра, которые в сочетании дают максимальную мощность свыше 270 л.с., передающуюся на колеса через вариатор. В результате мощность RX400h сопоставима с мощностью 8-цилиндрового V-образного двигателя, а расход топлива остается достаточно низким.

На малой скорости при заряженном аккумуляторе RX 400h приводится в движение только электромоторами. При движении без нагрузки на крейсерской скорости мощность на колеса передает бензиновый двигатель. Если требуется большая мощность, то бензиновый двигатель и электромоторы работают совместно, обеспечивая автомобилю непрерывный разгон. Раньше, когда вам нечем было заняться, вы развлекали себя прослушиванием музыки, теперь же настает время увлекающего коллекционирования зеленых кубиков. Речь идет об индикаторе зарядки батарей. При рваном ритме езды в батареях накапливается энергия о чем и свидетельствуют эти значки. Таким образом накопительство будет способствовать дальнейшим ускорениям.

Благодаря гибридному типу привода, RX 400h обладает плавным ходом, низким уровнем шума, а также лучшими в своем классе показателями расхода топлива и токсичности выхлопа. Еще одной особенностью, тесно связанной с HSD, является интеллектуальная система полного привода E-FOUR. Когда RX 400h трогается с места, разгоняется, тормозит или останавливается, тяговое усилие передается на все колеса, благодаря чему водитель чувствует себя уверенно и полностью контролирует автомобиль. Подключения задних колес происходит без сложных механизмов, так как вращаются они исключительно при помощи электромотора. При движении с крейсерской скоростью E-FOUR автоматически переключается в режим привода только на одну ось, чем уменьшает расход топлива. Теперь даже 4-цилиндровые бензиновые моторы окажутся в одной нише с Lexus по этому показателю.

Симбиоз электроники и двигателя внутреннего сгорания позволяет RX440h за 7,6 секунды перейти через психологический рубеж в 100 км/ч, затем разменяв 200 км/ч. Такие показатели стали возможны благодаря высокому крутящему моменту, создаваемому электромоторами. В то же время, он обладает традиционно низким уровнем шума во всем диапазоне оборотов двигателя.

Рекомендованная розничная цена на новый Lexus RX400h на российском рынке составляет 77.300 долларов.

автомобиль Lada 21730, 2011 г/в, г/н М 930 РХ 174, VIN ХТА217030В0329366 (залог)…

Статус: Несостоявшийся в связи с отсутствием допущенных участников

Регион: Челябинская область

Начальная цена: 188 700 ₽

Прием заявок: 22.04.2019 - 20.05.2019

Проведение торгов: 23.05.2019г.

Вид аукциона: Открытый аукцион

Вид торгов: Реализация имущества должников

Номер извещения: 180419/2754819/11

Предмет торга: Продажа

Обременение: залог

Форма изъятия имущества: Федеральный закон от 02.10.2007 № 229-ФЗ «Об исполнительном производстве»

Страна: РОССИЯ

Реквизиты документа — основания реализации имущества: Исполнительный лист

Место и порядок подачи заявок на участие в приватизации/продаже: Для подачи заявки необходимо произвести оплату задатка свидетельством чего является платежное поручение с отметкой банка об исполнении, подтверждающее внесение непосредственно претендентом задатка в счет обеспечения приобретаемого имущества.

Место и срок подведения итогов: После объявления о продаже имущества, с лицом выигравшим аукцион, подписывается протокол о результатах торгов. Настоящий Протокол составлен в трех экземплярах, имеющих одинаковую юридическую силу, один экземпляр Покупателю, один экземпляр для Государственного органа, один экземпляр для Продавца

Адрес сайта торгов: http://torgi.gov.ru/

Количество: 1.0 шт.

Челябинская обл, г Челябинск На карте

Организатор: ОБЩЕСТВО С ОГРАНИЧЕННОЙ ОТВЕТСТВЕННОСТЬЮ «ФАВОРИТ»

Вид: Коммерческая организация (иная)

Код: 2754819

Наименование вышестоящей организации: Территориальное управление Федерального агенства по управлению государственным имуществом в Челябинской области

ИНН: 7452059700

КПП: 745301001

ОКАТО: 75401000000

ОКПО: 82930326

ОГРН: 1087452000877

Почтовый адрес: 454080, Челябинская обл, г Челябинск, пр-кт Свердловский, д. 64, кв. 1

Контактный телефон: (351) 211-30-78, 211-30-79, 215-80-80

Факс: (351) 211-30-79

Фактический адрес: 454080, обл ЧЕЛЯБИНСКАЯ, г. ЧЕЛЯБИНСК, ул. Энтузиастов, 15Д, корпус 1

Контактное лицо: Пашнин Сергей Валерьевич

Место проведения аукциона: г Челябинск, ул. Энтузиастов, д. 15 «Д», корп. 1, офис 1

Абакан | Смертельное ДТП произошло под Саяногорском

31 декабря смертельное ДТП произошло на 72​ км автодороги «Абакан-Саяногорск» — сообщает ГИБДД по РХ

​По предварительной информации, водитель 1963 года рождения, управляя автомобилем Лада Калина, ​ ехал со стороны Абакана в сторону Саяногорска. Мужчина не справился с управлением, выехал встречку и лоб в лоб столкнулся с бензовозом с цистерной.

​58-летний водитель легковушки скончался на месте происшествия до приезда бригады скорой медицинской помощи.

В автомобиле находились так же женщина и двое детей. 4-летнюю девочку и травмами госпитализировали. Женщина и второй ребенок не пострадали.

​Отметим, что оба ребенка были пристегнуты ремнями безопасности.

По факту ДТП проводится проверка.

Фото: Гибдд по РХ

Новости соседних регионов по теме:

В Сакмарском районе спасатели деблокировали погибшего в ДТП водителя Лады Калины

Сегодня днем, 2 января в Центр управления в кризисных ситуациях поступило сообщение о ДТП в Сакмарском районе.
18:56 02.01.2022 Ria56.Ru — Оренбург

В ДТП на трассе Оренбург-Уфа погиб водитель «Калины». Его деблокировали

Смертельное ДТП случилось на территории Сакмарского района. Водитель «Лады-Калины» не справился с управлением и столкнулся с «NIVA-Chevrolet».
17:27 02.01.2022 Orenburg.Media — Оренбург

В Кировской области 1 января под колесами авто погибла женщина

ДТП произошло в 18:04 в Шабалинском районе. 64-летнюю пенсионерку насмерть сбил автомобиль Chevrolet Klan.
12:01 02.01.2022 VyatkaKirov.Ru — Киров

На Крымском мосту произошло смертельное ДТП

На Крымском мосту вечером 1 января произошло смертельное ДТП. На полном ходу автомобиль ВАЗ 2109 влетел под автокран.
10:50 02.01.2022 Crimea-news.com — Симферополь

В станице под Новочеркасском пьяный водитель на иномарке насмерть сбил 35-летнюю женщину

Трагедия произошла 1 января фото для иллюстрации www.kp40.ru В станице Грушевской 1 января в 21:20 на улице Советской произошло смертельное ДТП, сообщили отделе пропаганды УГИБДД по Ростовской области.
10:47 02.01.2022 RuffNews.Ru — Новочеркасск

Под Нижним Тагилом 39-летний мужчина погиб под колёсами молоковоза

1 января в 21:50 произошла смертельная авария на трассе Екатеринбург — Нижний Тагил — Серов.
12:00 02.01.2022 Между Строк — Нижний Тагил

Под Саяногорском в ДТП погиб водитель и пострадал 4-летний ребенок

По предварительной информации ГИБДД, на 72 километре автодороги «Абакан-Саяногорск» 31 декабря около 16:00 58-летний водитель, управляя автомобилем Лада Калина, двигаясь со стороны Абакана в сторону Саяногорска,
11:56 02.01.2022 ИА Запад24 — Красноярск

В первый день нового года в дорожной аварии погибли два человека в Дивногорске

В первый день нового года смертельное ДТП произошло в Дивногорске. По предварительной информации ГИБДД, накануне в 21:40 часов 31-летний водитель, управляя автомобилем «Toyota Chaser»,
10:50 02.01.2022 ИА Запад24 — Красноярск

Стали известны подробности смертельного ДТП в Великих Луках

Стали известны подробности смертельного ДТП в Великих Луках, произошедшего 31 декабря в 22:40 у дома 45/7 на улице Дьяконова.
22:30 01.01.2022 InformPskov.Ru — Псков

Под Воронежем перевернулась автомобилистка на «Ладе Калина»

В Семилукском районе 36-летняя жительница Воронежа не справилась с управлением своего автомобиля «Лада Калина» и съехала с дороги в кювет.
18:10 01.01.2022 Обозреватель.Врн — Воронеж

Смертельное ДТП произошло в Великих Луках 31 декабря

Смертельное ДТП произошло в Великих Луках вчера, 31 декабря, в 22.40. Об этом Псковской Ленте Новостей сообщили в пресс-службе УМВД России по Псковской области.
19:10 01.01.2022 Pln-Pskov.Ru — Псков

19-летний смолянин погиб под колесами иномарки

Смертельное ДТП произошло сегодня утром в Починковском районе. » В 5.40 на 290 км автодороги Р-120 водитель 1978 года рождения, управляя автомашиной «Форд», совершил наезд на пешехода 1992 года рождения,
17:55 01.01.2022 Газета Рабочий Путь — Смоленск

Под Мурманском лоб в лоб столкнулись автомобили

Фото: архив пресс-службы ГУ МЧС На 1369 километре трассы «Кола» произошло ДТП.
18:50 01.01.2022 SeverPost.ru — Мурманск

Водитель погиб в ДТП с двумя легковушками в Воронежской области

Авария произошла в Каширском районе Водитель погиб в ДТП с двумя легковушками в Воронежской области Авария со смертельным исходом произошла в Каширском районе рано утром 31 декабря.
14:30 01.01.2022 МОЁ! Online — Воронеж

В Ковылкинском районе автомобиль съехал в кювет и перевернулся

31 декабря в 9:14 в Ковылкинском районе Мордовии произошло ДТП. На автодороге «Ковылкино-Торбеево», на въезде в г. Ковылкино, автомобиль съехал в кювет и перевернулся.
14:11 01.01.2022 MordovMedia.Ru — Саранск

В Саранске в ДТП пострадал один человек

31 декабря в 10:20 в Октябрьском районе г.о. Саранск произошло ДТП. На ул.
13:40 01.01.2022 MordovMedia.Ru — Саранск

В Курске в столкновении «Фольксвагена» и «Мазды» 2 человека получили травмы

ДТП произошло в Курске 1 января. По предварительной информации УМВД, в 11:45 водитель автомобиля «Volkswagen Golf II», женщина 1983 г.р., ехала со стороны ул.
13:31 01.01.2022 ТРК Сейм — Курск

Под Воронежем в опрокинувшемся автомобиле 31 декабря погибла водитель «Лады Калины»

Полиция проводит проверку по факту аварии, случившейся в Семилукском районе вечером 31 декабря, сообщили в ГУ МВД по региону 1 января.
12:41 01.01.2022 Voronezh-News.Net — Воронеж

Сведения о результатах деятельности УМВД России по Ульяновской области за 31 декабря 2021 года

За 31 декабря в Ульяновской области сотрудники полиции установили лиц по трем ранее совершенным преступлениям, задержали одного преступника, находящегося в розыске, раскрыли одну кражу, три преступления экономической направленности.
12:22 01.01.2022 УМВД Ульяновской области — Ульяновск

Авторынок Казахстана: итоги ноября — новости Kapital.kz

Фото: Руслан Пряников

Продажи новых авто в Казахстане за ноябрь

По данным Ассоциации казахстанского автобизнеса (АКАБ), за ноябрь этого года в Казахстане было продано 9082 новых легковых автомобиля (включая пикапы и минивэны). Это на 3,3% меньше, чем в октябре, но на 10,8% больше, чем в ноябре прошлого года.

Результат одиннадцати месяцев 2021 года – 98 613 единиц новых автомобилей, что на 32,3% больше, чем в январе-ноябре 2020-го. По прогнозам АКАБ, в нынешнем году будет реализовано 110-115 тыс. новых автомобилей.

Десятку наиболее популярных брендов в ноябре по-прежнему возглавляет Chevrolet c результатом 2196 автомобилей (-14% к октябрю 2021 года), на второе место с четвертого поднялась Lada – 1482 единицы (+46%), на третьей строке по-прежнему Toyota – 1292 единицы (+24%), на четвертую позицию поднялась Kia — 919 единиц (+7%), на пятое место со второго опустился Hyundai — 884 единицы (-48%), на шестом месте Nissan – 470 единиц (+17%), на седьмом Renault – 407 единиц (+63%), на восьмом JAC – 288 единиц (-2%), на девятом Volkswagen – 214 единиц (-38%) и на десятом Haval – 209 единиц (+69%).

По итогам одиннадцати месяцев лидирует Chevrolet – 27 042 единицы (+292% к аналогичному периоду 2020 года), на втором месте Hyundai – 20 341 единица (+30,9%), на третьем Toyota – 12 741 единица (+37%), на четвертом Kia – 8773 единицы (+57,6%), на пятом Lada – 8156 единиц (-50,3%), на шестом Volkswagen – 4056 единиц (+83,5%), на седьмом Nissan – 3450 единиц (+62,4%), на восьмом Renault – 3136 единиц (+39,2%), на девятом JAC – 2476 единиц (+36,3%) и на десятом Lexus – 1649 единиц (+35,6%).

А вот так выглядит топ-10 самых популярных моделей в ноябре: седан B-класса Chevrolet Cobalt – 1199 единиц, седан D-класса Toyota Camry — 623 единицы, седан B-класса Chevrolet Nexia – 538 единиц, модель C-класса Lada Vesta – 442 единицы, универсал B-класса Lada Largus – 403 единицы, модель B-класса Lada Granta – 360 единиц, седан B-класса Hyundai Accent — 354 единицы, кроссовер С-класса Toyota RAV4 – 289 единиц, кроссовер D-класса Kia Sorento – 236 единиц, седан B-класса Kia Rio – 209 единиц.

По итогам одиннадцати месяцев в разрезе моделей лидирует Chevrolet Cobalt — 13 396 единиц, далее Chevrolet Nexia — 10 498 единиц, Hyundai Accent – 8 441 единица, Toyota Camry — 5123 единицы, Kia Rio — 4705 единиц, Hyundai Creta — 3335 единиц, Toyota RAV4 — 2949 единиц, Lada Vesta — 2737 единиц, Volkswagen Polo — 2585 единиц и Hyundai Elantra — 2441 единица.

В премиальном сегменте в ноябре расстановка сил по брендам следующая: на первом месте Lexus — 153 автомобиля (-25,7% к октябрю 2021 года), на втором BMW – 120 единиц (+12,1%), на третьем Infiniti – 43 единицы (+16,2%), на четвертом Mercedes – 44 единицы (+41,9%), на пятом Land Rover – 21 единица (+5%), на шестом Porsche – 16 единиц (+128,6%), на седьмом Cadillac – 14 единиц (-46,2%), на восьмом Audi – 7 единиц (+250%), на девятом Volvo – 4 единицы (-20%) и на десятом Mini – 2 единицы (+100%).

А это топ-10 наиболее популярных премиальных моделей в ноябре: кроссовер D-класса Lexus RX – 110 единиц, внедорожник F-класса Infiniti QX80 – 38 единиц, кроссовер Е-класса BMW X5 – 36 единиц, кроссоверы BMW Х6 и X7 — по 33 единицы, седан Е-класса Lexus ES – 21 единица, кроссовер Е-класса Mercedes GLE – 20 единиц, внедорожники Lexus LX и Mercedes GLS — по 12 единиц, внедорожники Lexus GX и Range Rover Sport — по 9 единиц, внедорожник Cadillac Escalade и кроссовер Porsche Cayenne — по 7 единиц, и кроссовер BMW X4 – 6 единиц.

При работе с материалами Центра деловой информации Kapital.kz разрешено использование лишь 30% текста с обязательной гиперссылкой на источник. При использовании полного материала необходимо разрешение редакции.

Гомогенный иммуноферментный анализ на основе FRET на фотонном кристалле на основе наночастиц

Anal Bioanal Chem. Авторская рукопись; доступно в PMC 1 июля 2016 г.

Опубликован в окончательной редакции как:

PMCID: PMC4481177

NIHMSID: NIHMS689485

Департамент машиностроения и аэрокосмической техники, Калифорнийский университет, Дэвис, Калифорния 95616, США

The publisher’s Окончательная отредактированная версия этой статьи доступна на сайте Anal Bioanal Chem. См. другие статьи в PMC, в которых цитируется опубликованная статья.

Abstract

Флуоресцентный резонансный перенос энергии (FRET) был протестирован в наноструктурированном массиве фотонных кристаллов (ПК) в зависимости от скорости и чувствительности иммуноанализа на основе белков. Карбоксилированные частицы размером 40 нм, конъюгированные с меченными донорами захватывающими антителами, улавливали электрофорезом и использовали в качестве донора энергии FRET. Матрица ПК может усиливать флуоресцентное возбуждение и излучение за счет фазового согласования. Чтобы продемонстрировать доказательство концепции FRET-гомогенного анализа на чипе ПК, был проведен иммуноанализ с использованием простой реакции на основе иммуноглобулина G (IgG).Стандартная кривая была построена путем тестирования двух разных реакций антител: 20 минут и 1 минута. Результаты сравнивали непосредственно с анализом FRET, в котором использовался современный высокочувствительный планшет-ридер с 96-луночным планшетом с временем реакции 1 час. Предел обнаружения кроличьих IgG составлял 0,001 мкг / мл и 0,1 мкг / мл в течение 20 минут и 1 минуты инкубации соответственно. Чувствительность была 10 3 и в 10 раз лучше, чем при обнаружении 96-луночного планшета. FRET на компьютерной иммуноплатформе продемонстрировал свой потенциал для реализации простой, но эффективной, быстрой и чувствительной технологии обнаружения.

Ключевые слова: Флуоресцентный резонансный перенос энергии, фотонный кристалл, иммуноанализ, наночастицы

Введение

Флуоресцентный резонансный перенос энергии (FRET) — это спектроскопический метод, включающий безызлучательный перенос энергии от молекулы флуоресцентного донора к молекуле акцептора за счет диполь-дипольное взаимодействие [1]. Эффективность передачи энергии определяется расстоянием между донором и акцептором [2]. Поскольку эффективность FRET чувствительно меняется с изменением расстояния между донором и акцептором, FRET широко используется в биотестах, которые основываются на связывании между биологическими молекулами, обеспечивая высокую чувствительность и специфичность [3].Кроме того, учитывая, что нет необходимости в разделении и очистке биологических молекул во время анализа, FRET является предпочтительным форматом для гомогенных иммуноанализов [4-6], которые предлагают сокращение ложноположительных результатов из-за снижения фоновой интерференции от ненормальных. специфическое связывание флуоресцентных меток с посторонними поверхностями.

Для получения высокой чувствительности от использования иммуноанализа на основе FRET в биосенсорах критически важно повысить эффективность передачи энергии между двумя разными флуоресцентными красителями, прикрепленными к биологическим молекулам, путем увеличения спектрального перекрытия и / или увеличения коэффициента экстинкции акцептора [ 7].Однако в целом флуоресцентные красители подвержены фотообесцвечиванию и имеют широкий спектр излучения и узкие спектральные полосы поглощения [8]. Квантовые точки (КТ) [4,7,8] или люминесцентные наночастицы с повышающим преобразованием [9-11] были рассмотрены в качестве альтернативных люминесцентных меток из-за их фотохимической стабильности и высокого квантового выхода, свойств, которые могут привести к надежности FRET на основе биосенсора, а также сверхвысокой чувствительности, когда-то встроенной в фотонный кристалл. В этом исследовании мы только проверили влияние наноструктуры фотонного кристалла на усиление FRET.

Гомогенный иммуноанализ (HIA) на основе FRET на фотонно-кристаллической (ПК) наноструктурированной матрице был продемонстрирован для общего иммуноанализа для обнаружения иммуноглобулина G (IgG). PC-иммуноплатформа способна усиливать флуоресцентный сигнал от образовавшегося иммуно-флюорокомплекса, что приводит к высокому отношению сигнал / шум [12]. Иммобилизация IgG на основе наночастиц с использованием системы улавливания электрофоретических частиц может минимизировать использование дорогостоящих биологических реагентов и улучшить общее время анализа по сравнению с другими методами иммобилизации [12–16].Из предыдущих исследований, ПК показали свое превосходство в различных видах иммуно- и ДНК-анализов на основе флуоресценции с точки зрения чувствительности [14-17]. Новое использование FRET на наноструктурированном массиве ПК устраняет присущие флуоресцентным красителям недостатки и одновременно обеспечивает простой, быстрый, но чувствительный метод быстрого обнаружения маркеров заболеваний в месте использования.

Материалы и методы

Материалы

Флуоресцентные наночастицы карбоксилированного полистирола (PS) 40 нм (F-8789; например: 660 нм / em: 680 нм) были приобретены в Invitrogen (Carlsbad, CA).В нашем случае флуоресценция частиц не играла роли в анализе FRET, как обсуждается ниже; эти конкретные частицы были просто подходящего размера и были легко доступны. Козий анти-кроличий IgG-Alexa 555 (донорная молекула с возбуждением: 555 нм и испусканием: 565 нм; A21428) был приобретен у Invitrogen. Кроличий IgG-Alexa 647 (акцепторная молекула с возбуждением: 650 нм и испусканием: 668 нм; SC-24647) был приобретен в Santa Cruz Biotechnology (Санта-Крус, Калифорния). Был синтезирован гаптен 3-ПБА.Подробный метод описан ранее [18]. Alexa 647 конъюгировали с гаптеном 3-PBA с использованием коммерческого набора для маркировки белков (A-20173, Invitrogen).

Иммуноанализ FRET с использованием 96-луночного планшета

96-луночный планшет (Maxisorp, Nunc) был покрыт козьим антикроличьим IgG (RIgG) -Alexa 555 в концентрации 128 мкг / мл в фосфатно-солевом буфере (PBS) в течение Инкубация 4 часа при 37 ° C. Затем лунки пять раз промывали PBS. Другие неспецифические участки лунки планшета блокировали, используя 300 мкл 2% бычьего сывороточного альбумина (БСА) в течение 1 часа при комнатной температуре.После удаления блокирующего раствора к нему добавляли 100 мкл кроличьего IgG (RIgG) -Alexa 647 при 10 -5 , 10 -4 , 10 -3 , 0,01, 0,1, 1 и 10 мкг / мл. колодцы. После 1 часа инкубации при комнатной температуре интенсивности флуоресценции получали при 670 нм с использованием планшет-ридера (Tecan infinite M1000Pro, Сан-Хосе, Калифорния). В качестве отрицательного контроля в лунки, покрытые антителом против кроличьего IgG-Alexa 555, добавляли гаптен-Alexa 647 из 3-феноксибензойной кислоты (3-PBA) в качестве мишени. Гаптен 3-PBA был выбран, потому что реагент уже был конъюгирован с Alexa 647 в нашей лаборатории и был легко доступен для нас.

Иммуноанализ FRET с использованием фотонно-кристаллического наноструктурированного массива

Один миллилитр 0,05% флуоресцентных карбоксилированных частиц PS был покрыт козьим анти-RIgG-Alexa 555 в деионизированной (DI) воде путем пассивной адсорбции в течение 2 часов при комнатной температуре при легком встряхивании . Было установлено, что количество антитела обеспечивает полное покрытие поверхности частицы в соответствии с протоколом, предоставленным поставщиком (Bangs Laboratories, TechNote 205). Частицы с анти-RIgG-Alexa 555 улавливали с помощью системы улавливания электрофоретических частиц (EPES) с последующим удалением раствора [19].После завершения улавливания частиц 10 мкл RIgG-Alexa 647 было добавлено по каплям на матрицу фотонных кристаллов и затем инкубировано в течение 20 минут или 1 минуты с последующим удалением раствора. Растворы частиц или IgG с поверхности массива удаляли с помощью потока Куэтта, который мы описали ранее [19]. Матрица возбуждалась лазером с длиной волны 532 нм, и сигналы собирались на длине волны 670 нм с использованием системы регистрации одиночных фотонов. Материалы и подробные процедуры изготовления наноструктурированного массива ПК с EPES для сборки наночастиц в лунке и системы регистрации одиночных фотонов были описаны ранее [14,17].

Результаты и обсуждение

Анализ FRET с использованием 96-луночного планшета

Мы провели иммуноанализ на основе FRET с использованием считывающего устройства на 96-луночном планшете, что является традиционным лабораторным методом. Семь различных концентраций RIgG-Alexa 647 наносили в лунки планшета, на которые уже было нанесено покрытие против RIgG-Alexa 555: 10 -5 , 10 -4 , 10 -3 , 0,01, 0,1, 1 и 10 мкг / мл. Чтобы получить исходную точку на стандартной кривой (), были выполнены три повтора.Для определения холостого шума использовали буфер PBS без RIgG. LOD был определен как концентрация RIgG, которая вызвала на три стандартных отклонения больше, чем сигнал фонового шума (пунктирная линия), что привело к 1 мкг / мл. Для проверки перекрестной реактивности анти-RIgG-Alexa 555 с другой молекулой-мишенью использовали 3-PBA-hapten-Alexa 647. Сигнал находился в интервале фонового шума.

Обнаружение RIgG в 96-луночном пате с использованием планшет-ридера. С помощью FRET было обнаружено семь различных концентраций RIgG-Alexa 647 в PBS: 10 -5 , 10 -4 , 10 -3 , 0.01, 0,1, 1 и 10 мкг / мл. Предел детализации определялся как среднее плюс три стандартных отклонения фонового шума (пунктирная линия). Планки погрешностей были основаны на стандартных отклонениях трех повторов.

Анализ FRET на наноструктурированном массиве ПК

Для выполнения иммуноанализов FRET на наноструктурированных массивах ПК () карбоксилированные флуоресцентные частицы PS, конъюгированные с анти-RIgG-Alexa 555, улавливали с помощью EPES. Использовали пять различных концентраций RIgG-Alexa 647: 10 -3 ,0.01, 0,1, 1 и 10 мкг / мл. На микросхеме ПК размером 37,5 × 25 мм было построено шесть матриц с шагом 5 мм. Матрицы могут использоваться независимо для измерения сигналов от всех пяти концентраций мишени на чипе. показывает стандартную кривую, которая количественно определяла концентрации RIgG-Alexa 647. Фоновый шум (в основном обратно рассеянный лазерный свет, который не был отклонен режекторным фильтром) от лазера длиной 532 м измерялся путем воздействия лазера на матрицы в отсутствие частиц. и реагенты для иммуноанализа.Сигнал составлял 114 ± 10 фотонов в секунду. Неспецифическое связывание другой молекулы-мишени с системами ПК измеряли с той же молекулой-мишенью, которая использовалась при обнаружении на 96-луночном планшете ридером. Сигнал, возникающий в результате теста, составлял 137 ± 29 фотонов в секунду, что не было значимым по сравнению с фоновым сигналом.

Схема FRET-гомогенного иммуноанализа на матрице фотонных кристаллов.

Обнаружение RigG с помощью матрицы фотонных кристаллов. Время инкубации 20 минут (◆) и 1 минута (●) использовали для иммунной реакции RIgG и анти-RIgG.Измеряли концентрации 10 -3 , 0,01, 0,1, 1, 10 мкг / мл. LOD составляли 10 -3 и 0,1 мкг / мл соответственно в течение 20 минут и 1 минуты. Планки погрешностей представляют собой стандартное отклонение на основе трех повторов.

Флуоресцентные частицы были выбраны потому, что размер частиц был совместим с размером лунок (диаметр лунки: 60 нм, глубина: 240 нм), которые были спроектированы для формирования усиленных электромагнитных волн в ПК. Флуоресценция частиц не использовалась в этом анализе, но мы оценили любой потенциал флуоресценции частиц, чтобы играть внешнюю роль.Фоновый сигнал FRET, генерируемый флуоресцентными частицами-анти-RIgG-Alexa 555, измерялся путем возбуждения 532 нм-лазером в отсутствие RIgG-Alexa 647. Измеренный сигнал передачи энергии от анти-RigG-Alexa 555 к флуоресцентная частица была незначительной по сравнению с фоновым шумом.

Чтобы продемонстрировать эффективность обнаружения ПК на основе FRET для быстрого оказания медицинской помощи, для связывания антитела с антителами использовались два разных времени инкубации (20 минут и 1 минута) ().Предел обнаружения при 20-минутной инкубации составил 0,001 мкг / мл, что в сто раз лучше, чем LOD, полученный при 1-минутной инкубации. Однако чувствительность, полученная после 1 минуты инкубации, была все еще в десять раз лучше, чем предел обнаружения с использованием планшет-ридера (1 мкг / мл). По сравнению с планшет-ридером массив ПК показал превосходство по чувствительности. В результате повышенной чувствительности иммуноплатформы ПК, инкубации в течение 1 минуты может быть достаточно для получения чувствительности, эквивалентной чувствительности системы считывания планшетов, что приводит к резкому сокращению времени анализа.Однако массив ПК может столкнуться с некоторыми ограничениями в применении, потому что выбор люминесцентных красителей и источника падающего света ограничен требованием фазового согласования массива, что ограничивает выбор красителей и источников возбуждения.

Выводы

Гомогенный иммуноферментный анализ на основе FRET устраняет необходимость промывания и упрощает иммуноанализ. Сила сигнала в обычном анализе на основе FRET может ограничивать чувствительность метода. Миграция формата FRET на матрицу фотонных кристаллов обеспечивает значительно улучшенную чувствительность по сравнению с обычным планшет-ридером без потери специфичности.Кроме того, матричная система FRET-PC может достичь уровней обнаружения, сопоставимых с гораздо более дорогими и сложными лабораторными приборами, всего за одну минуту.

Благодарность

Авторы благодарят профессора Б. Хаммока за разрешение использовать систему считывания планшетов. Мы благодарим A. Guillaumin за помощь в проведении иммуноанализов на основе FRET. Эта работа была поддержана Программой фундаментальных исследований Суперфонда Национального института гигиены окружающей среды (NIEHS) (No.P42ES004699).

Список литературы

1. Ko S, Grant SA. Новый оптоволоконный биосенсор на основе FRET для быстрого обнаружения Salmonella typhimurium. Biosens Bioelectron. 2006; 21: 1283–1290. [PubMed] [Google Scholar] 2. Lakowicz JR. Принципы флуоресцентной спектроскопии. Третье изд. Springer Science + Business Media, LLC; Нью-Йорк, штат Нью-Йорк: 2006. [Google Scholar] 3. Пулли Т., Хойхтя М., Содерлунд Х., Таккинен К. Одношаговый гомогенный иммуноанализ для малых аналитов. Anal Chem. 2005; 77: 2637–2642. [PubMed] [Google Scholar] 4.Цзэн Кью, Чжан И, Лю X, Ту Л., Конг X, Чжан Х. Множественные гомогенные иммуноанализы на основе наноплатформы FRET квантовых точек и золотых наностержней. Chem Commun. 2012; 48: 1781–1783. [PubMed] [Google Scholar] 6. Бу Д., Чжуан Х., Ян Дж., Пинг X. Иммуносенсор, разработанный для обнаружения полибромированных дифенилов на основе флуоресцентного резонансного переноса энергии (FRET) между углеродными точками и наночастицами золота. Датчики и исполнительные механизмы B: химические. 2014; 195 (0): 540–548. Doi: http://dx.doi.org/10.1016/j.snb.2014.01.079. [Google Scholar] 7.Деннис AM, Бао Дж. Квантовые точки-флуоресцентные белковые пары как новые зонды флуоресцентного резонансного переноса энергии. Nano Lett. 2008. 8 (5): 1439–1445. [PubMed] [Google Scholar] 8. Мединц И.Л., Клапп А.Р., Маттусси Х., Голдман Э.Р., Фишер Б., Мауро Дж. М.. Самособирающиеся наноразмерные биосенсоры на основе доноров квантовых точек FRET. Nat Mater. 2003; 2: 630–638. [PubMed] [Google Scholar] 9. Ван Л., Ян Р., Хо З., Ван Л., Цзэн Дж., Бао Дж., Ван Х, Пэн К., Ли Ю. Флуоресцентный биосенсор с резонансной передачей энергии на основе апконверсионных люминесцентных наночастиц.Биосенсоры. 2005; 44: 6054–6057. [PubMed] [Google Scholar] 10. Чаттерджи Д.К., Гнанасаммандхан М.К., Чжан Ю. Небольшие преобразовывающие флуоресцентные наночастицы для биомедицинских приложений. Маленький. 2010. 6 (24): 2781–2795. Doi: 10.1002 / smll.201000418. [PubMed] [Google Scholar] 11. Ки, Грегоркевич Т., Конг X, Алдерс М.К., Бума В.Дж., Чжан Х. Критическая толщина оболочки наноплатформы люминесценции сердцевины / оболочки с повышением частоты для применения FRET. Журнал писем по физической химии. 2011. 2 (17): 2083–2088. Doi: 10.1021 / jz200922f.[Google Scholar] 12. Хан Дж.Х., Судхендра Л., Ким Х.Д., Джи С.Дж., Гамак Б.Д., Кеннеди И.М. Сверхчувствительные встроенные иммуноанализы с фотонным кристаллом, собранным из наночастиц. САУ Нано. 2012. 6 (10): 8570–8582. [Бесплатная статья PMC] [PubMed] [Google Scholar] 13. Хан Дж.Х., Ким Х.Дж., Судхендра Л., Хасс Э.А., Джи С.Дж., Гамак Б.Д., Кеннеди И.М. Электрофорезное построение множества наночастиц для высокочувствительного иммуноанализа. Biosens Bioelectron. 2013; 41: 302–308. [Бесплатная статья PMC] [PubMed] [Google Scholar] 14. Хан Дж.Х., Ким Х.Дж., Судхендра Л., Джи С.Дж., Гамак Б.Д., Кеннеди И.М.Photonic Crystal Lab — On-a-Chip для обнаружения стафилококкового энтеротоксина B при низкой аттомолярной концентрации. Anal Chem. 2013; 85: 3104–3109. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Хан Дж.Х., Ван М.С., Дас Дж., Судхендра Л., Вонасек Э., Нитин Н., Кеннеди И.М. Захват и обнаружение бактериофагов Т7 на наноструктурированном интерфейсе. Интерфейсы приложения ACS Mater. 2014; 6: 4758–4765. [Бесплатная статья PMC] [PubMed] [Google Scholar] 16. Хан Дж.Х., Тан М., Судхендра Л., Вайс Р.Х., Кеннеди И.М. Выявление на чипе однонуклеотидного полиморфизма без амплификации полимеразы.Nano Res. 2014 г. Doi: 10.1007 / s12274-014-0494-z. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Хан Дж.Х., Судхендра Л., Ким Х.Д., Джи С.Дж., Гамак Б.Д., Кеннеди И.М. Сверхчувствительные встроенные иммуноанализы с фотонным кристаллом, собранным из наночастиц. САУ Нано. 2012 г. Doi: 10.1021 / nn301656c. [Бесплатная статья PMC] [PubMed] [Google Scholar] 18. Шан Джи, Хуанг Х, Стаутамир Д.В., Джи С.Дж., Ленг Джи, Hammock BD. Иммуноферментный анализ чувствительного класса для обнаружения метаболитов пиретроидов в моче человека. Chem Res Toxicol.2004. 17: 218–225. [PubMed] [Google Scholar] 19. Хан Дж.Х., Ким Х.Дж., Судхендра Л., Хасс Э.А., Джи С.Дж., Гамак Б.Д., Кеннеди И.М. Электрофорезное построение множества наночастиц для высокочувствительного иммуноанализа. Biosens Bioelectron. 2012 г. Doi: 10.1016 / j.bios.2012.08.042. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Как избавиться от беспокойства Buzz

Диагностика и лечение этой раздражающей рашпиля, которая появляется из ниоткуда.

Если в прошлый раз, когда у вас был полезный джем на улице, в вашу звуковую дыру не залетела пчела, то раздражающий звук, который вы слышите, будет ужасным жужжанием ладов.

Беспокоит каждого гитариста на многих этапах его игровой жизни, когда струна, которую вы щипаете, или струны, на которых вы играете, сильно вибрирует на грифе, а не над ним. Похоже, твоя гитара простыла!

За исключением рассинхронизации, ладовое жужжание, скорее всего, является первым «неприятным» звуковым явлением, с которым вы сталкиваетесь в своей игре. Но не волнуйтесь, это совершенно нормально, и такое случается со всеми нами. Ниже я перечислил все возможные причины и способы их устранения.

Техника

Давайте сначала рассмотрим технику.

Размещение

Лады довольно большие, но, как ни странно, вы не должны использовать большую часть пространства, доступного вашим пальцам. Правильное место для лада ноты — сразу за полосой лада.

То же самое касается аккордов, как и отдельных нот, поэтому, когда вы играете плавное соло или играете мечтательную последовательность аккордов, вам нужно поднести пальцы как можно ближе к ладу.

Когда вы ладите ноту правильно, вы вдавливаете струну в такт лада, а это означает, что вибрация идет от такта и далее, образуя приятную чистую ноту.

Если вы переместите палец ближе к середине лада, вы создадите две отдельные вибрации: одну вдоль лада до лада, а другую — от лада вперед. Первое — это то, что вызывает жужжание или дребезжание.

Давление

Ладное жужжание также будет возникать, если вы недостаточно нажимаете на ноту пальцем.Новые гитаристы борются с этим некоторое время (особенно во время аккордов barre), пока сила их пальцев не наберется.

Если честно, если я пытаюсь сыграть особенно страшный аккорд на шести ладах довольно далеко от грифа, это случается и со мной, и я играю уже более десяти лет.

В этом сценарии отсутствие давления на струну не позволяет изолировать вибрацию ноты. Вибрации проходят под вашим пальцем, заглушая ноту, уменьшая ее чистоту и сустейн.

Хорошая новость в том, что все, что вам нужно сделать, чтобы остановить это, — это сильнее надавить на веревку. Я знаю, что легче сказать, чем сделать, но с практикой мышцы пальцев адаптируются к задаче, и вам даже не нужно об этом думать.

И последнее замечание по поводу давления, прежде чем мы продолжим: не давите слишком сильно. Слишком сильное нажатие не вызовет шума, но оно утомит вас и, в некоторых случаях, даже слегка расстроит ноту.

Слишком энергичное бренчание или ощипывание

Если вы держите палец и давите на точку, но все еще слышите это подлое жужжание, проблема может быть в другой руке.

Слишком сильная игра на струнах или игра на струнах также может ухудшить чистоту играемых вами нот. Почему? Что ж, для хорошего ровного тона и приличного сустейна ваши гитарные струны должны вибрировать из стороны в сторону.

Когда вы поражаете их яростью богов, вы заставляете их раскачиваться вверх и вниз, а также из стороны в сторону, добавляя к ноте своего рода естественное искажение.

Итак, попробуйте поэкспериментировать с более мягкой динамикой и посмотрите, утихнет ли гудение. Это все, что касается технических предложений.Теперь давайте рассмотрим некоторые другие возможности.

Струны

Вас простят за то, что вы подумали, что струны могут начать плохо себя вести, когда они станут немного старше, но на самом деле это новый блестящий набор струн, который представляет наибольший риск возникновения шума. Конечно, старые струны действительно становятся черными и звучат как бы мертвыми, даже расстроенными, но это не то, что вызывает шум.

Гудение ладов возникает, когда вы меняете свои старые струны на новые другого калибра, особенно если новый калибр тоньше.Например, переход от 10 до 9 секунд вызовет ажиотаж.

Причина в том, что ваша гитара настроена на натяжение исходного набора струн. Когда вы используете другой набор, напряжение меняется, и форма шеи меняется. Если новые струны расположены слишком близко к ладам, вы можете обнаружить, что песню Стива Вая легче играть, но гудение неизбежно.

Настройка

Вы можете думать о настройке вашей гитары как о настройке всего инструмента, а не только струн.Он определяет наклон вашей шеи, высоту седла и действие ваших струн (насколько они выше грифа), угол и высоту звукоснимателя (электрика) и так далее.

После общей сборки ощущения от инструмента определяются вашей настройкой. Проблема в том, что настройки не вечны. По мере того, как ваша гитара подвергается воздействию разных температур, странному удару по стойке кровати и вашей жесткой игре, все начинает выходить из строя.

Самая распространенная причина гудения на плохо настроенных гитарах — слишком туго натянутый анкерный стержень, проходящий через гриф топора.Это снижает действие ваших струн, что, в свою очередь, вызывает жужжание ладов. Чтобы исправить это, вам нужно будет использовать шестигранный ключ, чтобы ослабить положение.

Ваше действие также можно установить слишком низко с помощью седел моста, и в этом случае вам понадобится небольшой шестигранный ключ, чтобы немного приподнять их.

Еще одним шумным аспектом гитары «без настройки» является то, что лады стали неровными. Губы естественны и неизбежны, но в конечном итоге их придется побрить, иначе вам придется приберечь свою гордость и радость для полноценного рефрета.Фактически, мой верный Telecaster почти готов к такому.

Самый простой способ решить эти проблемы — записаться на гитару к профессионалу, но если вы купите что-то вроде набора инструментов этого музыканта, вы сможете самостоятельно провести большую часть обслуживания и сэкономить немного денег. долгий пробег — ура!

Структурные проблемы

Единственная другая причина, по которой вы можете испытывать «жужжание лада», — это наличие более серьезных структурных проблем с вашим инструментом. В этом случае вам следует обратиться к мастеру.

Барабанить вверх

Вот и все, друзья. Теперь вы можете искоренить причину этого раздражающего шума и снова заставить шестиструнный звук снова петь. Наслаждаться!

Фотография Жала крупного плана и лад на — ID: 144484536 — Изображение

Фотография Укуса крупным планом и лад на — ID: 144484536 — Изображение RF — Stocklib 144484536 Вы здесь:
  • Home
  • Close-up Stings and Fret на электрогитаре.
© Stocklib / warin watkeaw
  • Id: 144484536
  • Тип носителя: Фотография
  • Автор: warin watkeaw / illumateofnat
  • Ключевые слова:

Крупный план Укусы и лад на электрогитаре.

Дополнительная информация 0,48 9025 36248 2709 пикселей
Размер Ширина * Высота МБ Кредиты
Маленькая сеть (jpg) 450 пикселей * 338 пикселей
Большая паутина (jpg) 799 пикселей * 599 пикселей 1,37 2
Мелкий шрифт (jpg) 1582 15246 5.37 3
Средняя печать (jpg) 2365 пикселей * 1774 пикселей 12 4
Крупный шрифт 27,99 5
Очень крупный шрифт (jpg) 4032 пикселей * 3024 пикселей 34,88 5040 пикселей * 3780 пикселей 54.51 10
Дополнительная информация 54,51
Размер Ширина * Высота МБ Кредиты
POEL (tiff) 50
EOEL (tiff) 5040 пикселей * 3780 пикселей 54,51 75
tiff6 54.51 100

Вы не авторизованы!

Войдите, чтобы скачать это изображение.

Невероятные материалы. Гибкая ценовая политика. Купите кредиты и начните скачивание сегодня.

Подождите, ваше изображение загружается

Jamstik 7 Fret Edition — 7 лучших гаджетов для идеального подарка на Дивали

Jamstik 7 Fret Edition — 7 лучших гаджетов для идеального подарка на Дивали | The Economic Times

Текст от Раджарши Б

От мониторинга качества воздуха в реальном времени до стильных электронных коньков — эти удивительные гаджеты станут идеальным подарком на Дивали в этом году.

Getty Images

На этом Дивали домой привезут очиститель воздуха, оснащенный системой мониторинга качества воздуха в реальном времени. Airmega 300S и 400S подключаются к Alexa, чтобы создать по-настоящему умный дом. Функции включают в себя включение и выключение устройства, регулировку скорости вращения вентилятора и настройку чувствительности интеллектуального режима, что позволяет устройству автоматически определять скорость вентилятора в зависимости от качества воздуха в помещении.

Agencies

3/8

Tomtom Spark 3 GPS Fitness Watch

Фестивали приводят к гастрономическим удовольствиям, поэтому они также требуют удвоения тренировок.Фитнес-часы Tomtom Spark 3 GPS могут отслеживать все ваши занятия спортом, бегом, плаванием, беговой дорожкой и занятиями в тренажерном зале, предлагают исследование маршрута, отслеживание GPS и многое другое. Он водонепроницаем до 40 метров и может отображать входящие звонки и тексты на экране.

Агентства

4/8

Jamstik 7 Fret Edition

Добавьте оригинальные мелодии в праздничные вечера с этой умной гитарой, которую можно носить куда угодно. Он тонкий, беспроводной и оснащен такими технологиями, как распознавание касания, оптические датчики и сенсорное управление.Он поставляется с приложением, в котором вы можете настроить звуки инструментов и настройки Jamstik.

Агентства

Ничто не сравнится с PX в подавлении праздничного шума и превращении вас в дзен. Он имеет 22 часа автономной работы и интеллектуальные элементы управления, которые естественным образом реагируют на ваше поведение, обеспечивая интуитивно понятное прослушивание. С помощью приложения PX вы можете легко настроить такие параметры, как фильтры среды и сквозную передачу голоса.

Агентства

В этот Дивали, обгоните своих соседей на стильном Segway Drift W1.Электронные коньки легкие, портативные и созданы для развлечения. Поскольку он имеет встроенную технологию самобалансировки, вам не нужно много бороться, чтобы к ней привыкнуть.

Агентства

Дивали не обходится без петард. Но не беспокойтесь о загрязнении. Проверьте электронные взломщики в ближайшем магазине или на сайтах электронной коммерции. Они напоминают обычные петарды и могут использоваться в помещении.

Агентства

Абсолютно новый Echo Show оснащен 10-дюймовым дисплеем высокой четкости с яркими визуальными эффектами, встроенным концентратором для умного дома и акустической системой, обеспечивающей впечатляющие басы и стереозвук.Итак, когда вы просите Alexa показать вам погоду, посмотреть видео или отобразить список покупок, это будет восхитительно. Скоро вы сможете использовать с ним интеграцию видеодомофона, которая работает с камерами дверного звонка Ring.

Агентства

Чтобы просмотреть свои сохраненные истории, щелкните ссылку, выделенную жирным шрифтом

Разработка генетически кодируемой системы FRET с использованием флуоресцентных РНК-аптамеров

Синтез YO3-ацетата

Et 3 N (0,26 мл, 1.86 ммоль, 1 экв.) Добавляли к перемешиваемому раствору 4 — [( E ) -2- (ацетилфениламино) этенил] -1-метилхинолиния иодида 28 (790 мг, 1,84 ммоль, 1 экв.) И 2- (2-метилбенз [ d ] оксазол-3-иум-3-ил) ацетат 42 (500 мг, 2,62 ммоль, 1,42 экв.) В DCM. Раствор оставляли перемешиваться на 20 ч с последующим концентрированием в вакууме. Затем твердое вещество ресуспендировали в DCM (150 мл), фильтровали и промывали ацетоном (3 × 10 мл). Твердое вещество сушили в вакууме с получением (85 мг, 12%) YO3-ацетата в виде аморфного твердого вещества пурпурного цвета. 1 H ЯМР (400 МГц, ДМСО- D6 ) δ 10,17 (с, 1H), 8,47-8,38 (м, 2H), 8,34-8,28 (м, 1H), 8,24-8,18 (м, 1H), 8,18–8,13 (м, 1H), 7,94–7,87 (м, 2H), 7,68–7,59 (м, 3H), 7,52–7,46 (м, 1H), 7,41–7,28 (м, 3H), 7,01–6,94 (м , 1H), 5,91–5,82 (м, 1H), 4,47 (с, 2H), 4,05 (с, 3H). HRMS (ESI) [M + , C 22 H 19 N 2 O 3 + ] требует м / z 359,1390, найдено 359,1395.

YO3 PEG 3-звенный синтез биотина амина

HBTU (45 мг, 3 экв.) И DIPEA (30 экв.) Добавляли к YO3-ацетату (3 мг, 1 экв.) В ДМФ (250 мкл).Раствору давали перемешиваться в течение 10 минут, после чего добавляли N -биотинил-3,6,9-триоксаундекан-1,11-диамин 43 (7 мг, 2 экв.) И раствор перемешивали в течение 18 часов. . Растворитель лиофилизировали и остаток повторно растворяли в 1: 1 MeCN / 50 мМ NH 4 OAc (водн.) . Затем раствор очищали с помощью ОФ-ВЭЖХ (25–50% MeCN против 50 мМ NH 4 OAc за 30 мин). RP-HPLC Rt = 14,9 мин. HRMS (ESI) [M + , C 40 H 51 N 6 O 7 S + ] требуется м / z 759.3534, обнаружено 759,3531.

Структурное моделирование РНК

Трехмерный (3D) дизайн базовой структуры оригами 2H-AE РНК был подробно описан ранее 24, 44 . Вкратце, с помощью программ 3D-моделирования Swiss-PdbViewer 45 и UCSF Chimera 46 две стандартные двойные спирали РНК А-формы были выровнены параллельно и повернуты, чтобы создать оптимальное расстояние для антипараллельного равномерного (AE) двойного кроссовера (DX). ). Внутренняя 180 ° целующаяся петля (HIV-1 DIS, PDB id: 2B8R) была расположена между кроссоверами, а тетрапетли UUCG (извлеченные из PDB id: 1F7Y) были расположены на концах двойных спиралей.Трехмерный дизайн конструкций apta-FRET был основан на структуре оригами 2H-AE РНК. Минимальное ядро ​​аптамера шпината (PDB id: 4Q9R), ранее использовавшееся для создания Bunch of Baby Spinach 47 , было расположено на одном из внешних доменов двойной спирали, фланкирующих DX. Мотив шпината был повернут так, чтобы направить дипольный момент DFHBI-1T либо прямо в сторону, либо от соседнего параллельного домена двойной спирали, где должен был располагаться аптамер манго. Ядро исходного аптамера шпината фланкируется двумя доменами с двойной спиралью, называемыми P1.2 и P2.1 Хуанг и др. 31 Это позволяет два разных варианта включения; «нормальная» версия, в которой домен P1.2 использовался для соединения шпината с РНК-оригами, и «перевернутая» версия (помеченная *), где домен P2.1 использовался для соединения шпината с РНК-оригами. Стебель-петля, построенная из стандартной двойной спирали А-формы и тетрапетли UUCG, была прикреплена к другому концу ядра шпината. Из-за стерических столкновений только две из четырех возможных версий оказались жизнеспособными; нормальная версия с диполем, направленным в сторону соседней двойной спирали, и перевернутая версия с диполем, направленным в сторону от соседней двойной спирали.Недавно опубликованная сокристаллическая структура аптамера манго выявила трехуровневый G-квадруплекс, связанный с доменом двойной спирали через тетрапетлевый мотив GAAA, и не позволяет манго «переворачивать», как шпинат. Связь между тетрапетлей и G-квадруплексом структурно не определена и, как ожидается, будет гибкой, а TO3-биотин (очень похож на YO3-биотин) не может быть смоделирован в связывающем кармане без стерических столкновений. Следовательно, мы не смогли смоделировать точное положение диполя флуорофора YO3-биотина.Чтобы найти оптимальное положение Mango, длина домена двойной спирали между Mango и ближайшим DX изменялась с шагом в две пары оснований. На некоторых позициях были стерические столкновения. После первоначального моделирования 3D-структуры были лигированы с помощью Perl-скрипта («ligate.pl», который доступен на нашей веб-странице www.andersen-lab.dk) и уточнены с помощью функции рекурсивного геометрического уточнения в Assemble2 48 . 3D-модели в этой работе были визуализированы в UCSF Chimera.

Расчет дипольного момента

Дипольный момент DFHBI-1T был рассчитан с помощью пакета программ Marvin (версия 15.10.19) и плагин Calculator, разработанный ChemAxon (http://www.chemaxon.com/). Химическая структура DFHBI-1T была нарисована в MarvinSketch, а состояние протонирования молекулы было определено при pH 7,8 с использованием подключаемого модуля pKa Calculator. Дипольный момент наиболее распространенных микровидов DFHBI-1T (70,4% при pH 7,8) был рассчитан с использованием подключаемого модуля Dipole Moment Calculator. Полный дипольный момент DFHBI-1T был визуализирован как вектор, выраженный в системе координат главной оси. Полученный файл, показывающий как химическую структуру, так и вектор дипольного момента DFHBI-1T, был экспортирован как файл pdb и импортирован в Swiss-PdbViewer 45 для выравнивания молекулы флуорофора с трехмерными координатами DFHBI из кристаллической структуры шпината (PDB id : 4Q9R).

Дизайн последовательности РНК

Процесс создания последовательности был подробно описан ранее 24, 44 . Вкратце, 3D-модели были загружены в Assemble2 48 для визуализации вторичной структуры, которые были вручную перенесены в текстовые файлы проекта 2D-структуры. Для apta-FRET с разветвленным KL мотив Т-образного соединения был создан в 2D-схеме путем замены двух выпуклых аденинов в одном из партнеров петли поцелуев на петлю-ножку. Последовательность консервативных мотивов РНК (KL, тетрапетли, шпинат, манго, РНК-захватчик) была сохранена, а оставшаяся последовательность была обозначена Ns.Каждая последовательность была дополнительно ограничена путем «блокировки» кроссоверов парами оснований GC, включения пары колебаний GU на каждые восемь непрерывных пар оснований и ограничения 5′-конца до 5′-GGGAGA-3 ‘, оптимальной последовательности инициации для T7. РНК-полимераза. 2D-чертежи были прочитаны сценарием Perl («trace.pl», который доступен на нашей веб-странице www.andersen-lab.dk), который выводит обозначение точечных скобок и ограничения последовательности, подходящие для проектирования последовательности в NUPACK 49 . Последовательности, разработанные в NUPACK, были свернуты и оценены с использованием mFold 50 .

Синтез ДНК-матриц

ДНК-матриц конструкций apta-FRET получали с помощью стандартной ПЦР-амплификации фрагментов гена gBlocks из IDT с использованием ДНК-полимеразы Phusion High-Fidelity (ThermoFischer Scientific). Амплификации выполняли в 1 × буфере Phusion HF (предоставленном производителем), 200 мкМ dNTP (invitrogen), 1 мкМ прямого (Fwd) и обратном (Rev) праймерах (заказанных у IDT), 4 нг gBlock и 1 ед. Полимеразы Phusion. ДНК-матрицы простых аптамеров получали с помощью стандартной ПЦР-амплификации ДНК-ультрамеров (IDT) с использованием ДНК-полимеразы Taq (Invitrogen).Амплификации выполняли в буфере Taq 1 × , 200 мкМ dNTP (invitrogen), 1,5 мМ MgCl 2 , 1 мкМ праймеров Fwd и Rev, 4 нг ультрамера и 2,5 мкМ ДНК-полимеразы Taq U . Праймеры Fwd и Rev были разработаны для каждой матрицы (см. Дополнительное примечание 2), а температуры отжига были рассчитаны с использованием калькулятора New England Biolabs (NEBs) T m (http://tmcalculator.neb.com/). Амплифицированную ДНК очищали с использованием набора для очистки ДНК GFX PCR (иллюстрация) и хранили в буфере ТЕ.

Транскрипция in vitro и очистка РНК

Транскрипция in vitro выполнялась путем смешивания ДНК-матрицы, транскрипционного буфера (15 мМ Mg (OAc) 2 , 50 мМ трис-ацетат pH 7,8, 40 мМ NaCl, 0,1% Tween20) , 1 мМ DTT и NTP (по 2,5 мМ каждый). Добавляли РНК-полимеразу Т7 (собственного производства), и образцы инкубировали при 37 ° C в течение не менее 4 часов. Реакцию останавливали, добавляя ДНКазу I (ThermoFischer Scientific) до концентрации 1 ед. / 100 мкл и инкубируя при 37 ° C в течение 15 мин.Транскрибируемую РНК очищали на 6% полиакриламидных гелях после смешивания 1: 1 с денатурирующим загрузочным буфером (95% формамид, 18 мМ EDTA, 0,025% SDS, бромфеноловый синий, ксилолцианол) и нагревания до 95 ° C в течение 5 минут. Полосы геля визуализировали с помощью УФ-затенения, вырезали из геля и элюировали в течение ночи свободным от нуклеаз H 2 O (Ambion). Кусочки геля отделяли от жидкости с использованием спин-колонок для гелевой экстракции ДНК Freeze’n’Squeeze (Bio-Rad), и, наконец, РНК осаждали этанолом, ресуспендировали в свободной от нуклеаз H 2 O и хранили при -20 ° C. .

Тепловой отжиг структур РНК оригами

Транскрибированная РНК была подвергнута тепловому отжигу перед использованием для обеспечения правильного сворачивания структур оригами РНК. Сначала РНК в свободной от нуклеаз H 2 O нагревали до 95 ° C в течение 5 минут, а затем быстро охлаждали при -20 ° C в течение 3 минут. Затем добавляли 5 × сборочный буфер (5 × TB, 625 мМ KCl, 5 мМ MgCl 2 ) до конечной концентрации 1 ×, и образцы оставляли при 37 ° C на 30 мин.

Измерения флуоресценции

Измерения флуоресценции были выполнены на FluoroMax 4 от Horiba, Jobin Yvon.Возбуждение DFHBI-1T и YO3-биотина проводили при 450 нм и 580 нм соответственно. Эмиссия DFHBI-1T и YO3-биотина регистрировалась при 503 нм и 620 нм соответственно. Щели монохроматора были установлены на 5 нм, а время интегрирования составляло 0,2 с. Измерения проводились на объемах образцов от 65 до 100 мкл, и использовались концентрации флуорофора 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина, если не указано иное. Относительные значения FRET были рассчитаны с использованием уравнения \ ({\ rm FRET} = \ frac {{I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y})}} {{I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm Y}) + I _ {\ rm {DY}} (ex _ {\ rm D}, em _ {\ rm D})}} \), где I DY ( ex D , em Y ) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T и I DY ( D em D ) — излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина.

Анализы связывания флуорофора и конкуренции

Анализы активации и конкуренции флуорофора проводили на структурах РНК-оригами, содержащих только шпинат или только манго, или с пустой структурой 2H-AE (дополнительное примечание 1). Конструкции были подвергнуты тепловому отжигу перед измерениями в соответствии с описанным выше протоколом. Концентрации как РНК, так и флуорофоров указаны на соответствующих рисунках. Измерения проводили в 1 × сборочном буфере.

Fluorophore EC

50 измерений

Было измерено сродство связывания с различными флуорофорами аптамеров, интегрированных в структуры оригами РНК. Конструкции перед использованием подвергали тепловому отжигу в соответствии с описанным выше протоколом, и образцы готовили в 1-кратном буфере для сборки. Измерения проводились с использованием серийно разведенных флуорофоров в концентрациях от 1 нМ до 2 мкМ. Все образцы готовили в трех экземплярах как с 20 нМ РНК, так и без нее, и флуоресценцию измеряли на VarioSkan Flash Reader (Thermo Scientific) путем возбуждения образцов, содержащих DFHBI-1T или YO3-биотин, при 450 нм или 580 нм, соответственно.Фоновую флуоресценцию от каждой концентрации флуорофора в отсутствие РНК вычитали из записанных интенсивностей перед вычислением ЕС 50 . EC 50 рассчитывали в GraphPad Prism 7.0b для Mac OS X, используя нелинейный регрессионный анализ «логарифм (агонист) против ответа (три параметра)» кривой доза-ответ.

Измерения усиления флуоресценции

Усиление флуоресценции было рассчитано для флуорофоров в минимальной версии аптамеров и для аптамеров, интегрированных в структуры оригами РНК.В целом, 1 мкМ РНК в 1 × буфере для сборки инкубировали со 100 нМ соответствующего флуорофора. Усиление флуоресценции рассчитывалось с использованием уравнения \ (F _ {\ rm {E}} = \ frac {{I _ {{\ rm {F}} + {\ rm {R}}}}} {{I _ {\ rm {F }}}} \), где I F + R — интенсивность флуоресценции флуорофора в присутствии РНК, а I F — интенсивность флуоресценции одного флуорофора (флуоресценция в выключенном состоянии).

Конформационные изменения в системе apta-FRET

Визуализация конформационных изменений в ответ на захватывающие РНК осуществлялась с помощью измерений с временным разрешением системы apta-FRET, содержащей разветвленный KL.Флуоресценцию как DFHBI-1T, так и YO3-биотина регистрировали каждые 30 с, а между измерениями заслонки закрывали, чтобы избежать обесцвечивания. Обратимая инвазия была получена путем добавления сначала РНК-захватчика с фиксатором до конечной концентрации 200 нМ к смеси 100 нМ структуры apta-FRET, 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотина с последующим добавлением «анти-захватчика». ”До конечной концентрации 400 нМ. Выходы FRET рассчитывались, как описано ранее.

Захватчик 1: UAGCUUAUCAGACUGAUGUUGAUAUAAAAG;

Анти-захватчик 1: CUUUUAUAUCAACAUCAGUCUGAUAAGCUA.

Захватчик 2: CUAGACUGAAGCUCCUUGAGGGAAGUUAG;

Анти-захватчик 2: CUAACUUCCCUCAAGGAG CUUCAGUCUAG.

EC

50 измерения SAM в датчике apta-FRET SAM

Сродство связывания SAM в датчике S6-M19-SAM было выполнено путем инкубации с серийно разведенным SAM в концентрациях от 1 мкМ до 2,5 мМ. Измерения проводили в трех повторностях с 50 нМ РНК в буфере для сборки, содержащем 1 мкМ DFHBI-1T и 1,7 мкМ YO3-биотин. Измерения проводились в VarioSkan Flash Reader путем возбуждения образцов при 450 нм и регистрации спектров флуоресценции от 470 до 700 нм.Выходы FRET и EC 50 рассчитывались, как описано ранее.

Процедура клонирования конструкций apta-FRET

Были выполнены стандартные этапы молекулярного клонирования. Во-первых, амплификацию и кодирование сайтов ограничения ( Bgl II и Eco RI) на концах матриц ДНК проводили с помощью ПЦР-амплификации с использованием ДНК-полимеразы Phusion, как описано выше (см. Дополнительное примечание 2 для последовательностей праймеров). После расщепления с использованием Bgl II и Eco RI (ThermoFischer Scientific — Fastdigest) в течение 30 минут при 37 ° C ДНК очищали с использованием набора для очистки GFX PCR (иллюстрация).pET28c-F30–2xdBroccoli был получен в подарок от Samie Jaffrey (плазмида Addgene № 66843). Плазмиду, полученную в компании на основе плазмиды pET28c, расщепляли с помощью Bgl II и EcoR I и очищали на 1% агарозном геле 0,5 × TBE. Линеаризованную плазмиду pET28c экстрагировали из геля с использованием набора для экстракции геля GFX (иллюстрация), и вставку лигировали в плазмиду в соотношении 1: 3 путем инкубации с ДНК-лигазой Т4 при 16 ° C в течение ночи. Реакционную смесь лигирования использовали непосредственно для трансформации плазмиды в DH5-alfa E.coli (NEB) с использованием стандартной процедуры теплового шока. Трансформированные бактерии высевали на LB-агар с канамицином (Kan, 50 мкг / мл) и инкубировали в течение ночи при 37 ° C. Отбирали отдельные колонии и инокулировали в LB-Kan (50 мкг / мл) в течение ночи при 37 ° C при энергичном встряхивании. Плазмиды выделяли с использованием набора GeneJET для плазмид miniprep (ThermoFischer Scientific) перед проверкой секвенированием в GATC-Biotech. Плазмиды с положительной последовательностью (~ 1 мкг) трансформировали в химически компетентные HT115 (DE3) E.coli собственного производства, и клоны с положительной трансформацией отбирали с использованием чашек с LB-агаром с Кан (50 мкг / мл) и тетрациклином (Tet, 12,5 мкг / мл), как описано в Hull and Timmons 51 .

Процедура и установка культивирования

Ночная (ON) культура была получена путем инокуляции отдельных колоний HT115 (DE3) -pET28c-FRET в 3 мл LB с Kan (50 мкг / мл) и Tet (12,5 мкг / мл) и позволили выращивать в аэробных условиях при 37 ° C при интенсивном встряхивании в течение ночи. Культуру разводили 1: 100 в LB-Kan и инкубировали в тех же условиях до OD 600 ~ 0.25–35 (~ 3 ч). Затем к половине образца добавляли IPTG (1 мМ) и инкубировали культуры в течение ~ 6–9 ч. Добавляли DFHBI-1T (50 мкМ) и YO3-биотин (85 мкМ), и культуры инкубировали в течение 30 мин. Различные культуры осаждали центрифугированием при 4000 × g в течение 5 минут перед ресуспендированием в свежей соли 1 × M9 (Sigma # M6030) и анализировали с помощью спектрофлуорометрии, проточной цитометрии или конфокальной микроскопии.

Спектрофлуориметрические измерения

Клетки, приготовленные, как описано выше, анализировали спектрофлуориметрическими измерениями в объеме 50 мкл. Готовили образцы, содержащие как DFHBI-1T, так и YO3-биотин, а также контроли, содержащие только DFHBI-1T или YO3-биотин.Возбуждение DFHBI-1T и YO3-биотина проводили при 450 и 580 нм соответственно. Выходы FRET были рассчитаны путем первого расчета возбуждения прямого акцептора, которое составило 1,5% (см. Дополнительную таблицу 2) от общего выброса YO3-биотина с использованием уравнения: \ (A _ {\ rm {dir}} = \ frac { {I _ {\ rm {Y}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} {{I _ {\ rm {Y}} (ex _ {\ rm {Y}}, em _ {\ rm {Y}})}} \), где \ (I_Y (ex_D, em_Y) \) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, и I Y ( ex Y , em Y ) представляет собой излучение на длине волны YO3-биотина после возбуждения YO3-биотина с присутствием только YO3-биотина.Далее была найдена интенсивность излучения, возникающего из хвоста DFHBI-1T на длине волны YO3-биотина; он был рассчитан как 7,4% (дополнительная таблица 2) от максимального выброса DFHBI-1T с использованием уравнения: \ (D _ {\ rm {leak}} = \ frac {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {D}})}} {{I _ {\ rm {D}} (ex _ {\ rm {D}}, em _ {\ rm {Y}})}} \) , где I D ( ex D , em D ) — это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T при наличии только DFHBI-1T, и I ( от D , em Y ) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только DFHBI-1T.\ ast I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) + I _ {\ rm {DY}} (ex _ {\ rm {D}}, em_ { \ rm {D}})}} \), где \ (I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {Y}}) \) — эмиссия в YO3- длина волны биотина после возбуждения DFHBI-1T, \ (I _ {\ rm {DY}} (ex _ {\ rm {Y}}, em _ {\ rm {Y}}) \) — это излучение на длине волны YO3-биотина после YO3- возбуждения биотина, а \ (I _ {\ rm {DY}} (ex _ {\ rm {D}}, em _ {\ rm {D}}) \) — это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T, все три с присутствием как DFHBI-1T, так и YO3-биотина.

Проточная цитометрия

Те же образцы, которые использовались для спектрофлуориметрических измерений (~ 50 мкл), разводили в 950 мкл соли 1 × M9 перед измерением на проточном цитометре Beckmann Coulter Gallios с лазером 488 нм и FL1 (575/30) и фильтры детектора FL3 (620/30).Для обработки данных использовалось программное обеспечение Kaluza Analysis. Эмиссию флуоресценции измеряли на 50 000 незащищенных клеток, содержащих как DFHBI-1T и YO3-биотин, так и только DFHBI-1T или YO3-биотин. Средние геометрические интенсивности закрытых клеток 2H-AE использовали в качестве фона и вычитали из средней геометрической интенсивности, измеренной на закрытых клетках, содержащих структуры apta-FRET. Интенсивность, возникающая из-за DFHBI-1T в канале FL3, была найдена с помощью \ (D _ {{\ rm {leak}}} = \ frac {{FL3 _ {\ rm {D}}}}} {{FL1 _ {\ rm {D} }}} \), где FL3 D и FL1 D — средние геометрические интенсивности в каналах FL3 и FL1 соответственно из ячеек, содержащих только DFHBI-1T.\ ast FL1 _ {{\ rm {DY}}} + FL1 _ {{\ rm {DY}}}}} \), где \ (FL3 _ {{\ rm {DY}}} \) — выбросы YO3-биотина длина волны после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина, \ (FL3 _ {\ rm {Y}} \) — это излучение на длине волны YO3-биотина после возбуждения DFHBI-1T с присутствием только YO3-биотина, и \ (FL1 _ {\ rm {DY}} \) — это излучение на длине волны DFHBI-1T после возбуждения DFHBI-1T с присутствием как DFHBI-1T, так и YO3-биотина.

Флуоресцентная микроскопия

Изображения флуоресцентной микроскопии получали с помощью Zeiss LSM 800 с масляным объективом 100X.Бактерии иммобилизовали на 96-луночных планшетах, покрытых поли-L-лизином (PLL) (µ-Plate, без покрытия, там же). 200 мкл PLL (10 мг / мл) вносили в лунки на 30 мин при 37 ° C, затем промывали свободной от нуклеаз H 2 O и сушили. В лунки добавляли 50 мкл культуры, приготовленной, как описано выше, в 1X солях M9, содержащих 100 мкМ DFHBI-1T и 17 мкМ YO3-биотин. DFHBI-1T возбуждали с использованием лазера 488 нм и регистрировали с использованием фильтра EGPF, а YO3-биотин возбуждали с помощью лазера 555 нм и регистрировали с использованием фильтра Texas Red.Сигнал FRET был получен путем возбуждения с использованием лазера 488 нм и записи с использованием техасского красного фильтра. Записанные изображения обрабатывались в MatLab (код доступен на нашей веб-странице www.andersen-lab.dk), где канал DFHBI-1T использовался для определения местоположения отдельных ячеек и определения их границ. Средняя интенсивность на пиксель в каждой ячейке была рассчитана для всех трех каналов. Клетки отбирали с использованием непосредственно возбуждаемой флуоресценции YO3-биотина и отбрасывали клетки с нижней 5% -ной интенсивностью, которая соответствует клеткам, не показывающим или показывающим очень низкую флуоресценцию YO3-биотина.Значения из каналов FRET и DFHBI-1T остальных ячеек использовались для расчета относительных выходов FRET с помощью уравнения \ ({\ rm {FRET}} = \ frac {{{I _ {\ mathrm {DY}}} ( {ex _ {\ mathrm D}}, {em _ {\ mathrm Y}})}} {{{I _ {\ mathrm {DY}}} ({ex _ {\ mathrm D}}, {em _ {\ mathrm Y}}) )} + {{I _ {\ mathrm {DY}}} ({ex _ {\ mathrm D}}, {em _ {\ mathrm D}})}} \), где \ (I _ {\ mathrm {DY}} { ({ex _ {\ mathrm D}}, {em _ {\ mathrm Y}})} \) — это излучение на длине волны YO3-биотина (техасский красный фильтр) после возбуждения DFHBI-1T и \ (I _ {\ mathrm {DY} } {({ex _ {\ mathrm {D}}}, {em _ {\ mathrm D}})} \) — излучение на длине волны DFHBI-1T (фильтр EGFP) после возбуждения DFHBI-1T.Оба были измерены с присутствием DFHBI-1T и YO3-биотина. Тепловая карта FRET была создана путем вычисления относительного вывода FRET на пиксель в границах выбранных ячеек с использованием того же уравнения.

Доступность данных

Авторы заявляют, что основные данные, подтверждающие выводы этого исследования, доступны в статье и файле с дополнительной информацией к ней. Дополнительные данные можно получить у соответствующего автора по запросу.

Mod Garage: Fighting Fret Wear

Привет, мододелы! Я снова чувствую желание поделиться еще одним советом по верстаку из моей ремонтной мастерской.(Но не прячьте этот паяльник, потому что мы вернемся к миру звукоснимателей, электролизеров, схем и хот-роддинга в следующей колонке.) На этот раз я хочу показать вам крутой способ сохранить ваш лады блестящие и гладкие. У этой техники есть большое побочное преимущество: она продлит жизнь вашим ладам. Хотя существует бесчисленное множество способов чистки и полировки ладов, это мой любимый. Это просто и не требует особых инструментов и материалов, и вы можете выполнять эту процедуру каждый раз, когда меняете струны.Если вы будете следовать этому режиму, ваши лады всегда будут в идеальном игровом состоянии — блестящие и гладкие, как мерцающая звезда. И это работает не только для гитар, но и для басов, мандолин, банджо и других ладовых инструментов.

Примечание: этот метод работает только в том случае, если у вас чистый гриф и лады в хорошем состоянии, на которых видны только признаки нормального игрового износа. Если ваш гриф покрыт грязью, а лады проржавели, ваша гитара требует более тщательного ухода — тема для другого дня.

Принадлежности. Это довольно короткий список, и вполне вероятно, что некоторые из этих предметов у вас уже есть дома. На фото 1 показаны предметы первой необходимости:

  • Старый кожаный ремень или полоска кожи, проданная для изготовления ремня. Важно, чтобы это была натуральная кожа, а не кожзам, Naugahyde, Rexine или какой-либо другой синтетический продукт. Неважно, окрашен ли ваш старый ремень в коричневый или черный, главное, чтобы он настоящий.
  • Несколько кусков твердой древесины, например клена, дуба или ольхи.
  • Салфетка для чистки серебра. Это то, что вы можете купить в любом ювелирном магазине, но убедитесь, что не , чтобы купить ткань для чистки золота. Это не годится для этой работы, как ткань, обработанная чистым серебром.
  • Масло для грифа или кондиционер по вашему выбору. Доступно бесчисленное множество вариантов. Два предостережения: не используйте силиконовое масло — оно не просочится в древесину грифа, а останется на поверхности и создаст беспорядок. Также не используйте кулинарное или салатное масло с кухни.Этот будет просачиваться в древесину грифа и, в конечном итоге, прогоркнет, станет липким и пахнет неприятным. Вы можете избежать этих неприятностей, выбрав продукт, предназначенный для гитарных грифов.
  • Старая футболка или кусок хлопчатобумажной ткани.
  • Свежий набор любимых струн.

Если вы будете следовать этому режиму, ваши лады всегда будут в идеальном игровом состоянии — блестящие и гладкие, как мерцающая звезда.

Создание собственного инструмента. Прежде чем мы перейдем к полировке, вам нужно немного повозиться с кожаным ремнем и деревом.Цель состоит в том, чтобы сделать небольшой полировальный блок с приклеенным к нему толстым кусочком кожи. Блок должен поместиться в руке, пока вы натираете кожу ладом, но с точки зрения размера у вас есть некоторая свобода: вы хотите кусок дерева большего размера, который покрывает сразу несколько ладов? Или вы хотите использовать небольшой блок для полировки одного лада за раз? Если у вас достаточно кожи, вы можете сделать несколько блоков размером, чтобы охватить все типы ладов и грифов. Вот что я сделал в своем магазине. Это дает мне возможность работать с разными инструментами.Между прочим, я использую кленовый лом для своих блоков, а моя кожа поступает из «заготовок для ремня», продаваемых поставщиками кожгалантереи.

Сначала отрежьте кусок дерева, который хотите использовать в качестве блока. Затем отрежьте соответствующий кусок кожи . Наконец, приклейте кожу к блоку так, чтобы гладкая сторона кожи была обращена наружу. Это поверхность, которая будет полировать лады. Вы можете использовать любой клей для домашнего творчества для этого последнего шага, но я обнаружил, что это супер клей и столярный клей не подходят для этой задачи.

Процесс шлифовки ладов. Сняв старые струны, протрите лады салфеткой для чистки серебра, пока они не станут сиять, как новые, что не займет много времени. Ткань потемнеет, когда вы начнете что-то полировать ею, но это нормально и не является признаком износа или износа. деградация. Никогда не стирайте эту чистящую ткань. Он прослужит очень долго, даже если он совсем потемнел. Ткань для полировки прослужит годы, прежде чем ткань начнет изнашиваться. Вы также можете использовать эту ткань для чистки серебра для всего хромированного и никелевого оборудования, такого как тремоло, крышки звукоснимателей, тюнеры и ручки.(Существуют специальные чистящие средства для черной и золотой фурнитуры.)

После того, как вы пройдете лады тканью для очистки, подождите несколько минут, затем снова протрите лады хлопчатобумажной тканью.

Теперь возьмите полировальную пластину с кожаной подкладкой и протрите дьяволицы с ладов, пока они не приобретут зеркальный блеск. Кожа также потемнеет во время использования, но, как и в случае с тканью для очистки, вы можете просто игнорировать это. Отполировав лады, проведите по ним пальцами.Вы будете поражены тем, насколько они гладкие и шелковистые. Так что же происходит с этой обработкой кожи? Погодите, мы вернемся к этому через мгновение.

Следующий шаг — только для гитар с грифом из розового или черного дерева. Для любой гитары с цельным кленовым грифом вы можете пропустить этот этап подготовки грифа. Нанесите на гриф масло или кондиционер по вашему выбору. Идите спокойно — используйте только каплю материала. В этом случае лучше меньше, да лучше. После того, как вы нанесли кондиционер, оставьте его на несколько часов, затем сотрите излишки хлопчатобумажной тканью.

Последний шаг: наденьте новые струны и начните причитать.


Фото 2 — Фото любезно предоставлены singlecoil.com

Кожаный моджо. В использовании кожи для отделки металла нет ничего нового. Если вы когда-нибудь наблюдали, как парикмахер рисует бритвой старой школы по кожаному «ремню», вы знаете, что это проверенная временем техника, которая до сих пор практикуется в винтажных парикмахерских (Фото 2). В отличие от наждачной бумаги или твердой бумаги. абразивов, кожа мягко встраивает частицы полировки в поверхность ладов, обеспечивая маслянисто-гладкую игру.

По сути, полировка кожи улучшает качество поверхности металла, делая его более устойчивым ко всем видам коррозии. Но это еще не все: вы можете не осознавать, что лады становятся тем труднее, чем старше они становятся и чем больше на них играют. Этот процесс похож на ковку, что приводит к уплотнению материала. [ Примечание редактора: Википедия описывает ковку как «производственный процесс, включающий формование металла с использованием локализованных сжимающих сил». ] Это внутреннее упрочнение в сочетании с повышенной коррозионной стойкостью, обеспечиваемой действием строппирования кожи, заметно продлит срок службы вашей кожи. лады.

В заключение несколько слов о коррозии: если два разных металла вступят в контакт с электролитами (например, пот с рук), основной металл, согласно электрохимическому ряду, начнет корродировать. На грубой поверхности, например, на стандартных ладах, электрохимические потенциалы изменятся и заметно ускорят процесс коррозии. Натяжение кожи предотвращает или значительно замедляет коррозию, поэтому ваши лады всегда будут в отличной форме. Чем мельче полируется лад, что еще больше снижает микро- и нано-шероховатость его поверхности, тем лучше он будет противостоять коррозии.

Вот и все. В следующем месяце мы исследуем наш следующий гитарный мод, так что следите за обновлениями. А пока продолжайте исправлять!

509 Превышен предел пропускной способности

509 Превышен предел пропускной способности Сервер временно не может обслуживать ваш запрос из-за того, что владелец сайта достиг своего ограничение пропускной способности.
Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *