Продажа квадроциклов, снегоходов и мототехники
second logo
Пн-Чт: 10:00-20:00
Пт-Сб: 10:00-19:00 Вс: выходной

+7 (812) 924 3 942

+7 (911) 924 3 942

Содержание

Не дает зарядку генератор ВАЗ 2110

Если вы обнаруживаете, что на вашем ВАЗ 2110 не дает зарядку генератор, следует немедленно искать причину неисправности, ведь под угрозой обеспечение всего электрооборудования током, а также – зарядка аккумулятора.

Генератор

Как известно, с исправным генератором аккумулятор не требует зарядки на протяжении многих месяцев и лет, сохраняя при этом не менее 60% заряда. То есть, аккумулятор емкостью 55 Ач, которыми обычно комплектуются десятки, восполняется током за счет работы исправного генератора.

Типы генераторов

Наиболее часто ВАЗ 2110 (с карбюраторным двигателем) оборудован генератором 9402.3701. На ВАЗ инжектор – 3202.3771 (с поликлиновым ремнем). Но в любом случае, неполадки одни и те же, их мы и рассмотрим.

Генератор 3202.3771

Основные неполадки

Если генератор начинает барахлить, то главные причины неисправности следует искать либо в бортовой сети, либо же это проблемы самого генератора. Если же генератор дает зарядку, но недостаточную, то, возможно, его слишком «нагрузили», поставив дополнительно к штатному электрооборудованию много других гаджетов, и он работает уже на пределе своих возможностей.

Уж больно наши автомобилисты полюбили тюнинговать ВАЗ 2110, добавляя, например, мощности динамиков, усиливая свет и т.п. Кое- кто в таких случаях меняет АКБ, например, ставит емкостью 70 Ач, вместо обычного ВАЗовского на 55 Ач.

Но если вначале это и может помочь, то со временем такая батарея будет садиться еще быстрее, поскольку штатный генератор не сможет обеспечить ее полную зарядку, не хватит у него для этого мощности.

Причины разрядки аккумуляторной батареи детально изложены в следующем материале: http://vazweb.ru/desyatka/elektrooborudovanie/razryazhaetsya-akkumulyator.html

Поиск неисправностей

Чтобы точно определить источник проблемы с генератором, нужно произвести элементарную проверку. Если у вас нет «добавочных» потребителей энергии, можете сразу искать неисправности генератора, если есть, отключите их все на время. Причем – не выключите, а именно отсоедините от автомобиля.

План проверки:

  1. Замерьте отдачу тока на холодном автомобиле, в то время, когда он не работает, и все системы его жизнеобеспечения отключены. Будет идеально, если отдачи вообще нет. Но такое случается крайне редко. Почти на каждом ВАЗ 2110 где-то из-за недостаточного контакта, локального замыкания и т.п. небольшая отдача все же наблюдается. Но – именно небольшая, а не такая, при которой аккумулятор может сесть за ночь стоянки;
  2. Если все нормально, утечки тока не наблюдается, или они мизерные, аккумулятор не разрядился, подключите обратно все те приборы, которые вы (не важно, самостоятельно или с помощью наемных специалистов) по собственной инициативе установили на автомобиль. Повторите ту же проверку. Если оказалось, что ток активно утекает, значит – причина не в АКБ и не связана с генератором, виновато именно не предусмотренное конструкторами ВАЗ 2110 устройство;
  3. Но если и тогда отдачи не обнаружено, переходим к тщательному обследованию генератора. А здесь возможных неисправностей немало:
    •    между щетками и кольцами ротора нет достаточного контакта;
    •    есть обрыв в обмотке возбуждения;
    •    возможно межвитковое замыкание непосредственно в катушке обмотки возбуждения. При этом генератор греется и гудит;
    •    обмотка возбуждения может замыкать на корпус ротора;
    •    обрывы могут возникать и в фазовой обмотке статора;
    •    статор может замкнуть на корпус;
    •    возможно замыкание «плюса» на корпус;
    •    в выпрямительном блоке может пробивать диоды;
    •    механические неисправности также занимают не последнее место в этом списке.

Произвести ремонт или замену генератора возможно и самостоятельно при должном желании и знании нюансов проведения процедуры. Подробности: http://vazweb.ru/desyatka/gena/remont-generatora.html 

Теперь рассмотрим все вышеозначенные неисправности генератора более подробно.

Слабый контакт

Контакт может становиться слабым при загрязнении или замасливании щеток, контактных колец ротора. Еще один виновник – усадка пружин, давящих на щетки, а также зависание самих щеток. Эти недостатки могут повышать сопротивление возбуждения и даже прервать цепь.

Обычно помогает протирание тряпкой, смоченной в бензине. Сильно изношенные щетки необходимо заменить новыми, заодно и проверить пружины. Если кольца окислились, им поможет чистка стеклянной шкуркой.

Обрыв обмотки

Если оборвана обмотка возбуждения, то нет и зарядки аккумулятора. Чтобы это определить, часто достаточно положить руку на генератор. При обрыве он греется. Для точной проверки нужно отсоединить от щетки конец обмотки возбуждения, к нему, и зажиму Ш генератора подсоединить (через вольтметр или лампочку) провода АКБ.

Если есть обрыв, то стрелка вольтметра не отклонится, а лампочка не загорится. Чтобы найти, какая из катушек не дает работать генератору, подключают к каждой по отдельности провода от АКБ. Напоследок проверяют пайки и выводы катушек. Если обрыв внутренний, катушку нужно заменить, при внешних помогает пайка.

Межвитковое замыкание

В любой из катушек обмотки возбуждения может возникнуть межвитковое замыкание. В этом случае обмотка греется, увеличивается ток возбуждения. Для определения замыкания недостаточно отметить, какая их них греется, нужно замерять омметром сопротивление каждой катушки.

Замыкание на корпус ротора

При этой неисправности замыкается вся обмотка возбуждения, и генератор попросту не работает. Чаще всего замыкает на корпус в местах, вывода концов обмотки к контактными кольцами ротора. Проверяют это лампочкой с напряжением 220 В.

Один провод подсоединяют к любому контактному кольцу, другой – к сердечнику ротора или его валу. Если есть замыкание, лампочка загорится. С таким генератором не поедешь, поэтому нужно или провести изоляцию, или заменить обмотку.

Замыкание в фазовой обмотке статора

Чаще всего замыкание возникает при разрушении изоляции между витками в катушках статора. При этом генератор сильно греется, он недостаточно заряжает АКБ, поскольку это происходит только на очень высоких оборотах коленвала.

Статор замыкает на корпус

Как и при других замыканиях, с генератором нелады: он сильно греется, гудит, снижается его мощность. Проверку проводят с помощью лампы 220 В. Один вывод помещают на сердечник, другой – на один из выводов обмотки. Если есть замыкание – лампа загорается. Ремонт состоит в замене дефектных катушек.

Зажим «плюс» замыкает на корпус

Эта неисправность не только ведет к сильному перегреву генератора, но и к пробою диодов в выпрямительном блоке. Что, в свою очередь, вызывает замыкание АКБ. Она может не только сильно разрядиться, но и выйти из строя.

Механические неисправности

Первое место среди механических неполадок ВАЗ 2110 занимает растяжение ремня. При этом обычно сильно греется шкив генератора. Кроме того, нет достаточной зарядки АКБ. Осмотрите также все на предмет плохого контакта, обламываний и т.п.

Статья, раскрывающая нюансы натяжки ремня генератора находится здесь: http://vazweb.ru/desyatka/gena/natyazhka-remnya-generatora.html

Поэтому, независимо от кого, карбюраторная у вас машина, или инжектор, с генератором лучше не шутить, а при обнаружении неисправностей быстро на них реагировать.

Оцените статью: Поделитесь с друзьями!

Пропала зарядка на ваз 2110 инжектор причины

Нет зарядки, возбуждения, не горит лампа АКБ ВАЗ-2110

#1 aleksei_159

  • Users
  • 55 сообщений
    • Марка авто: ВАЗ 2109
    • Откуда: г.Пермь

    Всем привет, купил 2111, не идет зарядка на АКБ, вернее нет возбуждения на генератор, при повороте ключа зажигания на приборной панели не загорается значек аккумулятора, лампочка рабочая 100%, провод возбуждения целый 100% (прозвонил). В чем может быть дело. при перегазовке напряжение поднимается.

  • VIP Member
  • 10 942 сообщений
    • Марка авто: Калина была.
    • Откуда: Р

    Предохранители проверяли? «+» на контрольной лампе есть?

    #3 aleksei_159

  • Users
  • 55 сообщений
    • Марка авто: ВАЗ 2109
    • Откуда: г.Пермь

    Предохранители проверяли? «+» на контрольной лампе есть?

    предохранитель не проверял, не могу понять какой нудно проверить, + на лампе есть

  • VIP Member
  • 4 833 сообщений
    • Марка авто: 21093

    предохранитель не проверял, не могу понять какой нудно проверить, + на лампе есть

    Какой пред,зависит от типа ЧЯ.

    Если на лампе АКБ есть плюс,горит лампа масла и приборы работают,то предохранитель исправный.

    Замкни фишку,снятую с возбуждения на генераторе на массу и глянь загорелась ли лампа АКБ при включении зажигания.

    • aleksei_159 это нравится

    #5 aleksei_159

  • Users
  • 55 сообщений
    • Марка авто: ВАЗ 2109
    • Откуда: г.Пермь

    Какой пред,зависит от типа ЧЯ.

    Если на лампе АКБ есть плюс,горит лампа масла и приборы работают,то предохранитель исправный.

    Замкни фишку,снятую с возбуждения на генераторе на массу и глянь загорелась ли лампа АКБ при включении зажигания.За

    Замкнул, Лампа загорелась!

  • VIP Member
  • 4 833 сообщений
    • Марка авто: 21093

    Замкнул, Лампа загорелась!

    Значит осталось только три причины:

    1.Неисправность регулятора напряжения,либо из-за открутившегося одного из его винтов пропал контакт с массой

    2.Запредельный износ хотя бы одной щетки регулятора

    3.Обрыв обмотки возбуждения ротора генератора.

    Начать проще со снятия,осмотра,проверки,или подмены РН.

    • aleksei_159 это нравится

    #7 aleksei_159

  • Users
  • 55 сообщений
    • Марка авто: ВАЗ 2109
    • Откуда: г.Пермь

    Значит осталось только три причины:

    1.Неисправность регулятора напряжения,либо из-за открутившегося одного из его винтов пропал контакт с массой

    2.Запредельный износ хотя бы одной щетки регулятора

    3.Обрыв обмотки возбуждения ротора генератора.

    Начать проще со снятия,осмотра,проверки,или подмены РН.

    Генератор на ваз 2110 не дает зарядку причины

    Генератор в автомобиле превращает механическую энергию в электрическую. После запуска автомобиля, генератор начинает работать и дает заряд аккумулятору, а также всему электрооборудованию, которое установлено на авто.

    Генератор находится под капотом, в работу его приводит коленвал. Иногда может случиться, что генератор на ваз 2110 не дает зарядку. Это может привести к обесточиванию автомобиля и спустя некоторое время движения автомобиля, он больше не сможет передвигаться.

    Где находится генератор ваз 2110

    Если генератор исправно работает, то не стоит периодически подзаряжать аккумулятор внешними зарядками. Он должен исправно работать в течении многого времени, заряжаясь только от генератора. В аккумуляторе должно постоянно оставаться 50-60% резервного заряда.

    Для автомобиля ваз 2110 могут использоваться два вида генераторов. Если автомобиль карбюраторный, то номер генератора будет 9402-3701. Если авто инжекторное, то номер генератора такой 3202-3771. Хоть они не особо и не отличаются между собой, но характер неисправностей у них одинаковый.

    Например, на ваз 2110 инжектор 8 клапанов генератор не дает зарядку, причин всего несколько:

    • на автомобиле установлено чрезмерное количество оборудования, которое питает большее количество электроэнергии. Это могут быть дополнительные колонки, аудио/видео устройства и различные насосы, пылесосы. Обычный генератор не справляется с такой нагрузкой и поэтому перестает исправно подавать заряд в аккумулятор.
    • не соответствие генератора и аккумулятора. Если в автомобиле установлено много дополнительного устройства, требующего питания электроэнергии, то владелец устанавливает аккумулятор помощнее. Объясняя это тем, что более мощного аккумулятора хватит на работу всех сторонних оборудований. А на самом деле генератор ваз 2110 выдаст мало заряда, причина в том, что его не хватит для сильного аккумулятора.

    Когда генератор автомобиля ваз 2110 не дает зарядку, причины могут быть и другие. Генератор может быть поврежден механически. Контакты со временем окисляются. Где-то могут просто отойти, плохое крепление проводов тоже может привести к неисправности генератора. Нужно уделять особое внимание ротору. Так как на корпусе ротора, может произойти замыкание.

    Причины поломки генератора ваз 2110

    Для того, чтобы выявить причину нарушения работы генератора, необходимо рассмотреть все возможные варианты его поломки по отдельности.

    • Сперва, по очередности необходимо отключать все цифровые устройства. Магнитолу, видеорегистратор, навигатор, колонки.
    • После того, как все отключено, автомобиль не заведен и не прогрет, необходимо измерить отдачу тока. Отметка должна быть на нуле. Чем выше отметка, тем быстрее будет садиться аккумулятор в автомобиле. Даже за ночь может разрядиться в ноль. Если показатель хороший, можно заново все подключать, а затем снова проверить отдачу тока.
    • Проблема может заключаться в самих подключаемых устройствах. Если показатели в норме, значит нужно проводить полную диагностику самого генератора.
    • Причиной неисправности генератора может быть замыкание статора, повреждение в обмотке возбуждения, обрывы, пропало соединение между рабочими элементами в генераторе. Но решение всегда существует, просто нужно знать, что делать.
    • Если все-таки дело в плохом соединение. Соединение может нарушиться из-за попадания масла на щетки, на кольца. Также если щетки зависают, если пружины осели. Иногда данную проблему можно решить просто, протерев бензином все. А иногда не обойдется без замены запчастей, которые уже износились. Если кольца окислились, их необходимо почистить с помощью наждачки.
    • Генератор может не работать из-за обмоточного разрыва. Тогда на аккумулятор не поступает вообще никакой зарядки. Проверить это проще простого, положите руку на аккумулятор, если он будет греться под рукой, значит все-таки обрыв.
    • Межвитковое замыкание. В любое время может начать греться обмотка и полетят катушки, поэтому нужно проверить все катушки по отдельности с помощью вольтметра.
    • Перемыкание на корпусе ротора. Из-за перемыкания происходит общее замыкание всей обмотки и узел весь перестает работать. Чтобы проверить неисправность достаточно взять лампочку и провода. Подключить их к любому контакту и к ротору. Если лампочка загорелась, значит замыкание есть. После необходимо полностью заменить всю обмотку.
    • Перемыкание на фазе обмотки. Если произошло перемыкание, то генератор будет сильно нагреваться и аккумулятор останется без зарядки.
    • Перемыкание статора. Также будет греться генератор. Появляется гул и различные звуки. Опять же проверить можно благодаря лампочке и проводам. Решение проблемы обычное – замена катушки.
    • Механические поломки генератора. Если шкив на генераторе перегревается, то заряд падает и аккумулятор получает незначительную зарядку. Прежде всего нужно делать диагностику всех контактов и искать переломанный.

    Другие причины почему генератор на ваз 2110 не дает зарядку

    Если проблема не в генераторе, а на панели горит зарядка, необходимо удостовериться в исправности лампочки на приборке и предохранителе.

    1. Нужно попробовать заменить предохранитель, завести автомобиль и проверить приборную панель. Если лампочка не горит, значит проблема была в предохранителе, генератор не нужно трогать.
    2. Иногда по дороге может оборвать ремень. Он изнашивается быстро, поэтому стоит постоянно возить с собой запасной, так как в любой момент его можно поменять и дальше передвигаться на автомобиле. Иногда ремень может просто ослабнуть и заряд на аккумулятор будет подаваться в меньшем количестве. Нужно просто с помощью регулировки подтянуть ремень, и проблема устранится.
    3. При постоянной эксплуатации автомобиля, аккумулятор меняют примерно через три года. Но не нужно забывать про генератор, который может ускорить износ аккумулятора. Из-за этого разные приборы и электрика выйдет из строя. Поэтому необходимо с особым вниманием наблюдать за генератором.

    Почему генератор ВАЗ-2110 не дает зарядку аккумулятору

    В стандартной комплектации автомобиля ВАЗ-2110 предусматривается наличие аккумулятора, емкость которого составляет 55 Ач. Он достаточно хорошо держит заряд и может не требовать его пополнения в течение многих месяцев. Все дело в том, что все потери напряжения компенсируются за счет функционирования генератора. Если последний по каким-либо причинам вышел из строя, очень важно своевременно обнаружить неисправность и устранить ее. В противном случае генератор не дает зарядку аккумулятора ВАЗ-2110 и создает серьезную угрозу для всей системы электроснабжения автомобиля.

    Главные причины, из-за которых генератор не дает зарядку АК

    Для выявления неполадок необходимо проводить диагностику как всей бортовой сети, которая может тянуть на себя слишком много энергии, так и самого генератора. Если вы делали тюнинг своего автомобиля, оснащая его дополнительным электрооборудованием, потребуется проверить уровень его энергопотребления и исправность.

    Очень часто для компенсации расхода тока сторонними устройствами автолюбители устанавливают АКБ повышенной емкости. Однако мощность генератора остается на прежнем уровне, поэтому данная мера не дает никакого эффекта.

    Диагностика авто, позволяющая выявить проблему с зарядкой аккумулятора

    Для начала нам потребуется проверить корректность работы индикатора заряда АКБ, расположенного на приборной панели. Вполне возможно, он просто показывает неверные данные, сбивая вас с толку и никакого серьезного ремонта не потребуется.

    Следующий важный шаг – проверка работоспособности предохранителя. Лучше сразу заменить его на заведомо исправное устройство и попытаться запустить двигатель. Если индикатор заряда сразу же гаснет, значит, проблема обнаружена и успешно решена.

    Аккумулятор по-прежнему не заряжается? Попытаемся обнаружить утечку тока, если таковая имеет место. Для этой цели проверяем автомобиль на холодную, когда все его системы полностью отключены. Небольшая отдача напряжения в такой ситуации считается нормой, так как практически в любой машине можно обнаружить слабый контакт на некоторых участках цепи, выявить локальное замыкание. Если же утечка настолько велика, что генератор не способен давать зарядку аккумулятору, следует бить тревогу.

    При отсутствии сильной отдачи тока проводим точно такую же проверку, но с подключением оборудования, установленного в процессе тюнинга. В этом случае причиной утечки будет именно оно. Самый простой способ решения проблемы – убрать все сторонние устройства.

    Выявляем неисправности генератора

    Вышеупомянутые проверки дают возможность быстро выявить неисправности элементов бортовой сети электроснабжения, короткие замыкания и прочие проблемы. Но если дело не в самой системе, потребуется диагностика генератора. В подавляющем большинстве случаев она выявляет одну из следующих проблем:

    • обрыв обмотки генератора. Он обнаруживается с помощью вольтметра, позволяющего измерить напряжение на выходе. Для устранения обрыва наружной обмотки достаточно осуществить пайку, внутренний же обрыв требует полной замены катушки;
    • замыкание между витками, выявляемое с помощью омметра. Генератор часто не может дать зарядку АКБ из-за повышенного сопротивления катушек;
    • недостаточный контакт между кольцами ротора и щетками. Основные причины этой проблемой – загрязнение деталей или ослабление пружин. В первом случае можно просто очистить поверхности щеток или колец, а во втором потребуется замена изношенных комплектующих;
    • замыкание на корпус, устраняемое либо качественной изоляцией генератора, либо заменой вышедшей из строя обмотки;
    • замыкание на корпус статора или плюсового зажима. «Лечится» установкой новых деталей;
    • растяжение ремня генератора, его сильное истирание или износ. В этом случае оборудование не только работает некорректно, но и сильно греется, благодаря чему можно быстро обнаружить проблему;
    • короткое замыкание в фазовой обмотке.

    Еще одна довольно распространенная проблема – это выход из строя регулятора напряжения генератора. Данное устройство устанавливается для того, чтобы нормализовать ток, вырабатываемый агрегатом и подаваемый в бортовую сеть, поддерживать его в строго определенных пределах. Эксплуатация авто со сломанным регулятором категорически запрещается, так как существуют весьма высокие риски выхода из строя всего электрооборудования. Поэтому очень важно своевременно обнаружить проблему и устранить ее.

    Почему генератор ВАЗ 2110 не дает зарядку и как это исправить?

    Если вы обнаруживаете, что на вашем ВАЗ 2110 не дает зарядку генератор, следует немедленно искать причину неисправности, ведь под угрозой обеспечение всего электрооборудования током, а также – зарядка аккумулятора.

    Как известно, с исправным генератором аккумулятор не требует зарядки на протяжении многих месяцев и лет, сохраняя при этом не менее 60% заряда. То есть, аккумулятор емкостью 55 Ач, которыми обычно комплектуются десятки, восполняется током за счет работы исправного генератора.

    Типы генераторов

    Наиболее часто ВАЗ 2110 (с карбюраторным двигателем) оборудован генератором 9402.3701. На ВАЗ инжектор – 3202.3771 (с поликлиновым ремнем). Но в любом случае, неполадки одни и те же, их мы и рассмотрим.

    Генератор 3202.3771

    Основные неполадки

    Если генератор начинает барахлить, то главные причины неисправности следует искать либо в бортовой сети, либо же это проблемы самого генератора. Если же генератор дает зарядку, но недостаточную, то, возможно, его слишком «нагрузили», поставив дополнительно к штатному электрооборудованию много других гаджетов, и он работает уже на пределе своих возможностей.

    Уж больно наши автомобилисты полюбили тюнинговать ВАЗ 2110, добавляя, например, мощности динамиков, усиливая свет и т.п. Кое- кто в таких случаях меняет АКБ, например, ставит емкостью 70 Ач, вместо обычного ВАЗовского на 55 Ач.

    Но если вначале это и может помочь, то со временем такая батарея будет садиться еще быстрее, поскольку штатный генератор не сможет обеспечить ее полную зарядку, не хватит у него для этого мощности.

    Причины разрядки аккумуляторной батареи детально изложены в следующем материале: https://vazweb.ru/desyatka/elektrooborudovanie/razryazhaetsya-akkumulyator.html

    Поиск неисправностей

    Чтобы точно определить источник проблемы с генератором, нужно произвести элементарную проверку. Если у вас нет «добавочных» потребителей энергии, можете сразу искать неисправности генератора, если есть, отключите их все на время. Причем – не выключите, а именно отсоедините от автомобиля.

    1. Замерьте отдачу тока на холодном автомобиле, в то время, когда он не работает, и все системы его жизнеобеспечения отключены. Будет идеально, если отдачи вообще нет. Но такое случается крайне редко. Почти на каждом ВАЗ 2110 где-то из-за недостаточного контакта, локального замыкания и т.п. небольшая отдача все же наблюдается. Но – именно небольшая, а не такая, при которой аккумулятор может сесть за ночь стоянки;
    2. Если все нормально, утечки тока не наблюдается, или они мизерные, аккумулятор не разрядился, подключите обратно все те приборы, которые вы (не важно, самостоятельно или с помощью наемных специалистов) по собственной инициативе установили на автомобиль. Повторите ту же проверку. Если оказалось, что ток активно утекает, значит – причина не в АКБ и не связана с генератором, виновато именно не предусмотренное конструкторами ВАЗ 2110 устройство;
    3. Но если и тогда отдачи не обнаружено, переходим к тщательному обследованию генератора. А здесь возможных неисправностей немало:
      • между щетками и кольцами ротора нет достаточного контакта;
      • есть обрыв в обмотке возбуждения;
      • возможно межвитковое замыкание непосредственно в катушке обмотки возбуждения. При этом генератор греется и гудит;
      • обмотка возбуждения может замыкать на корпус ротора;
      • обрывы могут возникать и в фазовой обмотке статора;
      • статор может замкнуть на корпус;
      • возможно замыкание «плюса» на корпус;
      • в выпрямительном блоке может пробивать диоды;
      • механические неисправности также занимают не последнее место в этом списке.

    Произвести ремонт или замену генератора возможно и самостоятельно при должном желании и знании нюансов проведения процедуры. Подробности: https://vazweb.ru/desyatka/gena/remont-generatora.html

    Теперь рассмотрим все вышеозначенные неисправности генератора более подробно.

    Слабый контакт

    Контакт может становиться слабым при загрязнении или замасливании щеток, контактных колец ротора. Еще один виновник – усадка пружин, давящих на щетки, а также зависание самих щеток. Эти недостатки могут повышать сопротивление возбуждения и даже прервать цепь.

    Обычно помогает протирание тряпкой, смоченной в бензине. Сильно изношенные щетки необходимо заменить новыми, заодно и проверить пружины. Если кольца окислились, им поможет чистка стеклянной шкуркой.

    Обрыв обмотки

    Если оборвана обмотка возбуждения, то нет и зарядки аккумулятора. Чтобы это определить, часто достаточно положить руку на генератор. При обрыве он греется. Для точной проверки нужно отсоединить от щетки конец обмотки возбуждения, к нему, и зажиму Ш генератора подсоединить (через вольтметр или лампочку) провода АКБ.

    Если есть обрыв, то стрелка вольтметра не отклонится, а лампочка не загорится. Чтобы найти, какая из катушек не дает работать генератору, подключают к каждой по отдельности провода от АКБ. Напоследок проверяют пайки и выводы катушек. Если обрыв внутренний, катушку нужно заменить, при внешних помогает пайка.

    Межвитковое замыкание

    В любой из катушек обмотки возбуждения может возникнуть межвитковое замыкание. В этом случае обмотка греется, увеличивается ток возбуждения. Для определения замыкания недостаточно отметить, какая их них греется, нужно замерять омметром сопротивление каждой катушки.

    Замыкание на корпус ротора

    При этой неисправности замыкается вся обмотка возбуждения, и генератор попросту не работает. Чаще всего замыкает на корпус в местах, вывода концов обмотки к контактными кольцами ротора. Проверяют это лампочкой с напряжением 220 В.

    Один провод подсоединяют к любому контактному кольцу, другой – к сердечнику ротора или его валу. Если есть замыкание, лампочка загорится. С таким генератором не поедешь, поэтому нужно или провести изоляцию, или заменить обмотку.

    Замыкание в фазовой обмотке статора

    Чаще всего замыкание возникает при разрушении изоляции между витками в катушках статора. При этом генератор сильно греется, он недостаточно заряжает АКБ, поскольку это происходит только на очень высоких оборотах коленвала.

    Статор замыкает на корпус

    Как и при других замыканиях, с генератором нелады: он сильно греется, гудит, снижается его мощность. Проверку проводят с помощью лампы 220 В. Один вывод помещают на сердечник, другой – на один из выводов обмотки. Если есть замыкание – лампа загорается. Ремонт состоит в замене дефектных катушек.

    Зажим «плюс» замыкает на корпус

    Эта неисправность не только ведет к сильному перегреву генератора, но и к пробою диодов в выпрямительном блоке. Что, в свою очередь, вызывает замыкание АКБ. Она может не только сильно разрядиться, но и выйти из строя.

    Механические неисправности

    Первое место среди механических неполадок ВАЗ 2110 занимает растяжение ремня. При этом обычно сильно греется шкив генератора. Кроме того, нет достаточной зарядки АКБ. Осмотрите также все на предмет плохого контакта, обламываний и т.п.

    Статья, раскрывающая нюансы натяжки ремня генератора находится здесь: https://vazweb.ru/desyatka/gena/natyazhka-remnya-generatora.html

    Поэтому, независимо от кого, карбюраторная у вас машина, или инжектор, с генератором лучше не шутить, а при обнаружении неисправностей быстро на них реагировать.

    Нет зарядки от генератора на ВАЗ 2110, что делать?

    Если генератор перестал давать зарядку, ничего хорошего в этом нет. Необходимо сразу приступать к поиску причины такой неисправности. В противном случае все ваше электрооборудование окажется без питания, а аккумулятор в скором времени полностью сядет.

    Если генератор работает хорошо, тогда аккумуляторная батарея не будет нуждаться в дополнительной зарядке специальными устройствами в течение многих месяцев, порой даже лет. В АКБ стабильно будет сохраняться минимум 60% заряда. Таким образом, аккумуляторы постоянно восполняют запас заряда за счет работы генератора.

    Внешний вид устройства

    Что стоит на ВАЗ 2110

    Для автомобилей ВАЗ 2110 предусматривается установка двух типов генераторов, в зависимости от установленного двигателя.

    1. Для карбюраторных моделей устанавливается генератор с номером 9402.3701.
    2. Если двигатель инжекторный, тогда каталожный номер используемого генератора будет 3202-3771. Он имеет поликлиновый ремень.

    Вне зависимости от типа установленного двигателя и генератора соответственно, неполадки на устройствах встречаются одни и тех же, потому процедура проверки и ремонта в обоих случаях идентична.

    Неисправности

    Есть две основные причины, из-за которых генератор перестает должным образом обеспечивать зарядку.

    Причина

    Особенности

    Случается такое у тех, кто любит устанавливать многочисленное дополнительное оборудование, которое питание за счет генератора, то есть требует электроэнергии. Это могут быть динамики, электронасосы, видеоустройства и пр. Штатный генератор на такие нагрузки не рассчитан, потому теряет эффективность

    Несоответствие АКБ и генератора

    Чтобы обеспечить работу электрооборудования, дополнительно установленного на автомобиль, многие решают установить более мощную аккумуляторную батарею при штатном генераторе. Несоответствие мощностей приводит к тому, что генератор перестает обеспечивать должную зарядку более мощного аккумулятора. Так ему попросту не хватает для этого ресурсов

    Какой заряд выдает генератор

    Многих интересует вопрос о том, сколько же генератор должен выдавать для нормального функционирования.

    Здесь параметры напрямую зависит от текущего состояния автомобиля.

    • Если двигатель холодный, только включается, тогда напряжение составит в норме 14,1-14,4 Вольт;
    • Если проверять напряжение после длительных поездок в условиях пробок, тогда генератор будет выдавать уже меньше, около 13,9-14,1В.

    Поиск причин неисправностей

    Отсутствие зарядки может быть вызвано широким перечнем причин, о которых мы сегодня поговорим.

    К таковым причинам относят:

    • Слабые контакты;
    • Обрывы обмотки;
    • Замыкание на роторном корпусе;
    • Межвитковые замыкания;
    • Механические поломки;
    • Замыкание зажима плюса на корпусе;
    • Замыкание в фазовой обмотке;
    • Замыкание статора на корпусе.

    Рассмотрим эти ситуации более детально, чтобы определить истинную причину поломки конкретно в вашем случае.

    Начните с того, что отключите все дополнительное оборудование в вашем автомобиле, которое не предусмотрено штатной комплектацией — видеорегистратор, навигатор, аудиосистема и пр.

    Далее выполняем следующие операции.

    1. Измерьте отдачу тока, когда автомобиль холодный, он не работает и все системы жизнеобеспечения отсоединены. Если отдачи совсем не будет, это хорошо. Но происходит это редко. Практически всегда на десятках может быть недостаточный контакт, какое-то замыкание, по причине которого отдача есть, но небольшая. Куда хуже, если отдача внушительная и приводит к разрядке аккумулятора за одну ночь, проведенную на стоянке или в гараже.
    2. Если все в норме, сильных утечек тока нет или они незначительные, а аккумуляторная батарея сохранил свой заряд, тогда можно вернуть все приборы на места, которые были установлены дополнительно.
    3. Проведите повторную проверку отдачи. Если при этом приборы показывают активную утечку тогда, тогда причина кроется не в аккумуляторе, не связана с генератором. Виновником проблемы является одно из устройств, подключенных дополнительно.
    4. Если и при этом отдача не наблюдается, тогда нужно внимательно осмотреть генератор.
    5. Источников неприятностей, которые могут привести к выходу из строя генератора, существует множество. К ним относят:
    • Недостаточный контакт между кольцами ротора и щетками;
    • В обмотке возбуждения произошел обрыв;
    • Возникло межвитковое замыкание на катушке обмотки возбуждения. В таком случае генератор будет гудеть и сильно греться;
    • Обмотка возбуждения замыкает на корпус ротора;
    • Статор замыкает на корпус;
    • Возникает обрыв в фазовой обмотке статора;
    • Пробились диоды в выпрямительном блоке, то есть диодном мосту;
    • Замкнуло плюс на корпусе;
    • Появились механические неисправности.

    Далее мы детальнее рассмотрим каждую из представленных выше причин.

    Разобранный агрегат

    Решение проблем

    1. Слабый контакт. Ослабление контакта может происходить по причине загрязнения, попадания масла на щетки, контактные кольца. Также контакт может ухудшиться из-за усадки пружин, которые давят на щетки, либо зависли щетки. Подобные явления приводят к повышению сопротивления возбуждения и порой способны оборвать цепь. Для устранения проблемы иногда достаточно просто обработать поверхности ветошью, вымоченной в бензине. Если щетки износились, их лучше заменить. Параллельно проверьте состояние пружин, колец. Кольца окисляются, потому обработайте их стеклянной наждачкой.

    1. Оборвалась обмотка. Если это произойдет, пропадет зарядка АКБ. Для определения проблемы положите руку на аккумулятор. При наличии обрыва устройство начнет греться. Если хотите более точную проверку, тогда отключите конец обмотки возбуждения от щетки и подсоедините к нему и зажиму Ш провода АКБ, используя вольтметр или лампочку. При наличии обрыва лампа не загорится, а стрелка вольтметра не сдвинется с места. Проверьте каждую катушку отдельно, чтобы определить, какая из них не дает генератору работать. Внутренние катушки подлежат замене, а внутренние паяются.

    Схема агрегата

    1. Замыкание между витками. Межвитковое замыкание может произойти в любой катушке обмотки возбуждения. Если такая ситуация произошла, обмотка начнет греться, ток возбуждения увеличится. Для проверки обязательно измерьте показатели сопротивления каждой катушки. Для этого вам пригодится вольтметр.

    1. Замыкание на корпусе ротора. Такая поломка приводит к тому, что вся обмотка возбуждения замыкается. Генератор прекращает свою работу. Наиболее распространенным участком замыкания являются места вывода концов обмотки к кольцам ротора. Для проверки используйте лампочку на 220В. Один провод следует подключить к любому контакту кольца, а второй — на сердечник или вал ротора. Если замыкание имеется, тогда лампочка включится. Эксплуатация автомобиля с таким генератором невозможна. Необходимо изолировать или полностью заменить неисправную обмотку. Первый вариант подойдет только для того, чтобы доехать до СТО и провести полноценный ремонт.

    1. Замыкание на фазной обмотке. Такого рода проблема возникает из-за того, что разрушается изоляция, имеющаяся между витками катушки статора. Если это произошло, генератор начнет сильно греться, аккумуляторная батарея не будет получать достаточный заряд, так как это происходит при высоких показателях оборотов коленчатого вала.
    2. Замыкание статора на корпусе. Как и в случае с другими перечисленными вариантами замыкания, в этой ситуации генератор начинает перегреваться, гудеть, его мощность существенно падает. Для проверки вам потребуется лампочка с мощностью 220В. Один провод подключается к сердечнику, а второй — на вывод обмотки. Любой. При наличии замыкания ваша лампочка загорится. Чтобы устранить проблему, достаточно просто заменить вышедшую из строя катушку.
    3. Плюсовой зажим замыкает на корпус. Такая неисправность неприятна тем, что она не просто перегревает ваш генератор. Также из-за данного замыкания происходит пробой диодов выпрямительного блока. Оттуда проблема переходит на аккумуляторную батарею, которую может попросту замкнуть. Не редко замыкание приводило к полному выходу аккумулятора из строя. Хотя чаще всего он просто полностью разряжается.
    4. Механические проблемы. Если принимать во внимание все возможные механические неполадки генератора, тогда на первом месте по частоте будет растяжение ремня. Это наиболее популярная поломка в случае с ВАЗ 2110. Если это произойдет, шкив начнет серьезно перегреваться, у аккумуляторной батареи будет недостаточная зарядка. Не лишним мероприятием является проверка качества всех контактов, наличия обломов соединений и прочих возможных механических проблем.

    При обнаружении проблем с генератором следует незамедлительно приступать к мероприятиям, направленным на устранения поломки. Если опыта нет, обращайтесь исключительно на проверенные станции технического обслуживания.

    Генератор — это сердце электросистемы вашего автомобиля. Словно главный орган человека, он обеспечивает питание всех приборов, устройств. Потому к нему следует относиться очень бережно и при возникновении неполадок не затягивать с ремонтом.

    Пропала зарядка ваз 2110 — Авто журнал kupim-avto57.ru

    Нет зарядки от генератора на ВАЗ 2110, что делать?

    Если генератор перестал давать зарядку, ничего хорошего в этом нет. Необходимо сразу приступать к поиску причины такой неисправности. В противном случае все ваше электрооборудование окажется без питания, а аккумулятор в скором времени полностью сядет.

    Если генератор работает хорошо, тогда аккумуляторная батарея не будет нуждаться в дополнительной зарядке специальными устройствами в течение многих месяцев, порой даже лет. В АКБ стабильно будет сохраняться минимум 60% заряда. Таким образом, аккумуляторы постоянно восполняют запас заряда за счет работы генератора.

    Внешний вид устройства

    Что стоит на ВАЗ 2110

    Для автомобилей ВАЗ 2110 предусматривается установка двух типов генераторов, в зависимости от установленного двигателя.

    1. Для карбюраторных моделей устанавливается генератор с номером 9402.3701.
    2. Если двигатель инжекторный, тогда каталожный номер используемого генератора будет 3202-3771. Он имеет поликлиновый ремень.

    Вне зависимости от типа установленного двигателя и генератора соответственно, неполадки на устройствах встречаются одни и тех же, потому процедура проверки и ремонта в обоих случаях идентична.

    Неисправности

    Есть две основные причины, из-за которых генератор перестает должным образом обеспечивать зарядку.

    Причина

    Особенности

    Случается такое у тех, кто любит устанавливать многочисленное дополнительное оборудование, которое питание за счет генератора, то есть требует электроэнергии. Это могут быть динамики, электронасосы, видеоустройства и пр. Штатный генератор на такие нагрузки не рассчитан, потому теряет эффективность

    Несоответствие АКБ и генератора

    Чтобы обеспечить работу электрооборудования, дополнительно установленного на автомобиль, многие решают установить более мощную аккумуляторную батарею при штатном генераторе. Несоответствие мощностей приводит к тому, что генератор перестает обеспечивать должную зарядку более мощного аккумулятора. Так ему попросту не хватает для этого ресурсов

    Какой заряд выдает генератор

    Многих интересует вопрос о том, сколько же генератор должен выдавать для нормального функционирования.

    Здесь параметры напрямую зависит от текущего состояния автомобиля.

    • Если двигатель холодный, только включается, тогда напряжение составит в норме 14,1-14,4 Вольт;
    • Если проверять напряжение после длительных поездок в условиях пробок, тогда генератор будет выдавать уже меньше, около 13,9-14,1В.

    Поиск причин неисправностей

    Отсутствие зарядки может быть вызвано широким перечнем причин, о которых мы сегодня поговорим.

    К таковым причинам относят:

    • Слабые контакты;
    • Обрывы обмотки;
    • Замыкание на роторном корпусе;
    • Межвитковые замыкания;
    • Механические поломки;
    • Замыкание зажима плюса на корпусе;
    • Замыкание в фазовой обмотке;
    • Замыкание статора на корпусе.

    Рассмотрим эти ситуации более детально, чтобы определить истинную причину поломки конкретно в вашем случае.

    Начните с того, что отключите все дополнительное оборудование в вашем автомобиле, которое не предусмотрено штатной комплектацией — видеорегистратор, навигатор, аудиосистема и пр.

    Далее выполняем следующие операции.

    1. Измерьте отдачу тока, когда автомобиль холодный, он не работает и все системы жизнеобеспечения отсоединены. Если отдачи совсем не будет, это хорошо. Но происходит это редко. Практически всегда на десятках может быть недостаточный контакт, какое-то замыкание, по причине которого отдача есть, но небольшая. Куда хуже, если отдача внушительная и приводит к разрядке аккумулятора за одну ночь, проведенную на стоянке или в гараже.
    2. Если все в норме, сильных утечек тока нет или они незначительные, а аккумуляторная батарея сохранил свой заряд, тогда можно вернуть все приборы на места, которые были установлены дополнительно.
    3. Проведите повторную проверку отдачи. Если при этом приборы показывают активную утечку тогда, тогда причина кроется не в аккумуляторе, не связана с генератором. Виновником проблемы является одно из устройств, подключенных дополнительно.
    4. Если и при этом отдача не наблюдается, тогда нужно внимательно осмотреть генератор.
    5. Источников неприятностей, которые могут привести к выходу из строя генератора, существует множество. К ним относят:
    • Недостаточный контакт между кольцами ротора и щетками;
    • В обмотке возбуждения произошел обрыв;
    • Возникло межвитковое замыкание на катушке обмотки возбуждения. В таком случае генератор будет гудеть и сильно греться;
    • Обмотка возбуждения замыкает на корпус ротора;
    • Статор замыкает на корпус;
    • Возникает обрыв в фазовой обмотке статора;
    • Пробились диоды в выпрямительном блоке, то есть диодном мосту;
    • Замкнуло плюс на корпусе;
    • Появились механические неисправности.

    Далее мы детальнее рассмотрим каждую из представленных выше причин.

    Разобранный агрегат

    Решение проблем

    1. Слабый контакт. Ослабление контакта может происходить по причине загрязнения, попадания масла на щетки, контактные кольца. Также контакт может ухудшиться из-за усадки пружин, которые давят на щетки, либо зависли щетки. Подобные явления приводят к повышению сопротивления возбуждения и порой способны оборвать цепь. Для устранения проблемы иногда достаточно просто обработать поверхности ветошью, вымоченной в бензине. Если щетки износились, их лучше заменить. Параллельно проверьте состояние пружин, колец. Кольца окисляются, потому обработайте их стеклянной наждачкой.

    1. Оборвалась обмотка. Если это произойдет, пропадет зарядка АКБ. Для определения проблемы положите руку на аккумулятор. При наличии обрыва устройство начнет греться. Если хотите более точную проверку, тогда отключите конец обмотки возбуждения от щетки и подсоедините к нему и зажиму Ш провода АКБ, используя вольтметр или лампочку. При наличии обрыва лампа не загорится, а стрелка вольтметра не сдвинется с места. Проверьте каждую катушку отдельно, чтобы определить, какая из них не дает генератору работать. Внутренние катушки подлежат замене, а внутренние паяются.
    Схема агрегата
    1. Замыкание между витками. Межвитковое замыкание может произойти в любой катушке обмотки возбуждения. Если такая ситуация произошла, обмотка начнет греться, ток возбуждения увеличится. Для проверки обязательно измерьте показатели сопротивления каждой катушки. Для этого вам пригодится вольтметр.

    1. Замыкание на корпусе ротора. Такая поломка приводит к тому, что вся обмотка возбуждения замыкается. Генератор прекращает свою работу. Наиболее распространенным участком замыкания являются места вывода концов обмотки к кольцам ротора. Для проверки используйте лампочку на 220В. Один провод следует подключить к любому контакту кольца, а второй — на сердечник или вал ротора. Если замыкание имеется, тогда лампочка включится. Эксплуатация автомобиля с таким генератором невозможна. Необходимо изолировать или полностью заменить неисправную обмотку. Первый вариант подойдет только для того, чтобы доехать до СТО и провести полноценный ремонт.

    1. Замыкание на фазной обмотке. Такого рода проблема возникает из-за того, что разрушается изоляция, имеющаяся между витками катушки статора. Если это произошло, генератор начнет сильно греться, аккумуляторная батарея не будет получать достаточный заряд, так как это происходит при высоких показателях оборотов коленчатого вала.
    2. Замыкание статора на корпусе. Как и в случае с другими перечисленными вариантами замыкания, в этой ситуации генератор начинает перегреваться, гудеть, его мощность существенно падает. Для проверки вам потребуется лампочка с мощностью 220В. Один провод подключается к сердечнику, а второй — на вывод обмотки. Любой. При наличии замыкания ваша лампочка загорится. Чтобы устранить проблему, достаточно просто заменить вышедшую из строя катушку.
    3. Плюсовой зажим замыкает на корпус. Такая неисправность неприятна тем, что она не просто перегревает ваш генератор. Также из-за данного замыкания происходит пробой диодов выпрямительного блока. Оттуда проблема переходит на аккумуляторную батарею, которую может попросту замкнуть. Не редко замыкание приводило к полному выходу аккумулятора из строя. Хотя чаще всего он просто полностью разряжается.
    4. Механические проблемы. Если принимать во внимание все возможные механические неполадки генератора, тогда на первом месте по частоте будет растяжение ремня. Это наиболее популярная поломка в случае с ВАЗ 2110. Если это произойдет, шкив начнет серьезно перегреваться, у аккумуляторной батареи будет недостаточная зарядка. Не лишним мероприятием является проверка качества всех контактов, наличия обломов соединений и прочих возможных механических проблем.

    При обнаружении проблем с генератором следует незамедлительно приступать к мероприятиям, направленным на устранения поломки. Если опыта нет, обращайтесь исключительно на проверенные станции технического обслуживания.

    Генератор — это сердце электросистемы вашего автомобиля. Словно главный орган человека, он обеспечивает питание всех приборов, устройств. Потому к нему следует относиться очень бережно и при возникновении неполадок не затягивать с ремонтом.

    Нет зарядки, возбуждения, не горит лампа АКБ ВАЗ-2110

    #1 aleksei_159

  • Users
  • 69 сообщений
    • Марка авто: ВАЗ 2111, Калина
    • Откуда: г.Пермь

    Всем привет, купил 2111, не идет зарядка на АКБ, вернее нет возбуждения на генератор, при повороте ключа зажигания на приборной панели не загорается значек аккумулятора, лампочка рабочая 100%, провод возбуждения целый 100% (прозвонил). В чем может быть дело. при перегазовке напряжение поднимается.

    #2 111

  • VIP Member
  • 11 009 сообщений
    • Марка авто: Калина была.
    • Откуда: Р

    Предохранители проверяли? «+» на контрольной лампе есть?

    #3 aleksei_159

  • Users
  • 69 сообщений
    • Марка авто: ВАЗ 2111, Калина
    • Откуда: г.Пермь

    Предохранители проверяли? «+» на контрольной лампе есть?

    предохранитель не проверял, не могу понять какой нудно проверить, + на лампе есть

    #4 t808

  • VIP Member
  • 5 011 сообщений
    • Марка авто: 21093

    предохранитель не проверял, не могу понять какой нудно проверить, + на лампе есть

    Какой пред,зависит от типа ЧЯ.

    Если на лампе АКБ есть плюс,горит лампа масла и приборы работают,то предохранитель исправный.

    Замкни фишку,снятую с возбуждения на генераторе на массу и глянь загорелась ли лампа АКБ при включении зажигания.

    • aleksei_159 это нравится

    #5 aleksei_159

  • Users
  • 69 сообщений
    • Марка авто: ВАЗ 2111, Калина
    • Откуда: г.Пермь

    Какой пред,зависит от типа ЧЯ.

    Если на лампе АКБ есть плюс,горит лампа масла и приборы работают,то предохранитель исправный.

    Замкни фишку,снятую с возбуждения на генераторе на массу и глянь загорелась ли лампа АКБ при включении зажигания.За

    Замкнул, Лампа загорелась!

    #6 t808

  • VIP Member
  • 5 011 сообщений
    • Марка авто: 21093

    Замкнул, Лампа загорелась!

    Значит осталось только три причины:

    1.Неисправность регулятора напряжения,либо из-за открутившегося одного из его винтов пропал контакт с массой

    2.Запредельный износ хотя бы одной щетки регулятора

    3.Обрыв обмотки возбуждения ротора генератора.

    Начать проще со снятия,осмотра,проверки,или подмены РН.

    • aleksei_159 это нравится

    #7 aleksei_159

  • Users
  • 69 сообщений
    • Марка авто: ВАЗ 2111, Калина
    • Откуда: г.Пермь

    Значит осталось только три причины:

    1.Неисправность регулятора напряжения,либо из-за открутившегося одного из его винтов пропал контакт с массой

    2.Запредельный износ хотя бы одной щетки регулятора

    3.Обрыв обмотки возбуждения ротора генератора.

    Начать проще со снятия,осмотра,проверки,или подмены РН.

    Почему генератор ВАЗ-2110 не дает зарядку аккумулятору

    В стандартной комплектации автомобиля ВАЗ-2110 предусматривается наличие аккумулятора, емкость которого составляет 55 Ач. Он достаточно хорошо держит заряд и может не требовать его пополнения в течение многих месяцев. Все дело в том, что все потери напряжения компенсируются за счет функционирования генератора. Если последний по каким-либо причинам вышел из строя, очень важно своевременно обнаружить неисправность и устранить ее. В противном случае генератор не дает зарядку аккумулятора ВАЗ-2110 и создает серьезную угрозу для всей системы электроснабжения автомобиля.

    Главные причины, из-за которых генератор не дает зарядку АК

    Для выявления неполадок необходимо проводить диагностику как всей бортовой сети, которая может тянуть на себя слишком много энергии, так и самого генератора. Если вы делали тюнинг своего автомобиля, оснащая его дополнительным электрооборудованием, потребуется проверить уровень его энергопотребления и исправность.

    Очень часто для компенсации расхода тока сторонними устройствами автолюбители устанавливают АКБ повышенной емкости. Однако мощность генератора остается на прежнем уровне, поэтому данная мера не дает никакого эффекта.

    Диагностика авто, позволяющая выявить проблему с зарядкой аккумулятора

    Для начала нам потребуется проверить корректность работы индикатора заряда АКБ, расположенного на приборной панели. Вполне возможно, он просто показывает неверные данные, сбивая вас с толку и никакого серьезного ремонта не потребуется.

    Следующий важный шаг – проверка работоспособности предохранителя. Лучше сразу заменить его на заведомо исправное устройство и попытаться запустить двигатель. Если индикатор заряда сразу же гаснет, значит, проблема обнаружена и успешно решена.

    Аккумулятор по-прежнему не заряжается? Попытаемся обнаружить утечку тока, если таковая имеет место. Для этой цели проверяем автомобиль на холодную, когда все его системы полностью отключены. Небольшая отдача напряжения в такой ситуации считается нормой, так как практически в любой машине можно обнаружить слабый контакт на некоторых участках цепи, выявить локальное замыкание. Если же утечка настолько велика, что генератор не способен давать зарядку аккумулятору, следует бить тревогу.

    При отсутствии сильной отдачи тока проводим точно такую же проверку, но с подключением оборудования, установленного в процессе тюнинга. В этом случае причиной утечки будет именно оно. Самый простой способ решения проблемы – убрать все сторонние устройства.

    Выявляем неисправности генератора

    Вышеупомянутые проверки дают возможность быстро выявить неисправности элементов бортовой сети электроснабжения, короткие замыкания и прочие проблемы. Но если дело не в самой системе, потребуется диагностика генератора. В подавляющем большинстве случаев она выявляет одну из следующих проблем:
    • обрыв обмотки генератора. Он обнаруживается с помощью вольтметра, позволяющего измерить напряжение на выходе. Для устранения обрыва наружной обмотки достаточно осуществить пайку, внутренний же обрыв требует полной замены катушки;
    • замыкание между витками, выявляемое с помощью омметра. Генератор часто не может дать зарядку АКБ из-за повышенного сопротивления катушек;
    • недостаточный контакт между кольцами ротора и щетками. Основные причины этой проблемой – загрязнение деталей или ослабление пружин. В первом случае можно просто очистить поверхности щеток или колец, а во втором потребуется замена изношенных комплектующих;
    • замыкание на корпус, устраняемое либо качественной изоляцией генератора, либо заменой вышедшей из строя обмотки;
    • замыкание на корпус статора или плюсового зажима. «Лечится» установкой новых деталей;
    • растяжение ремня генератора, его сильное истирание или износ. В этом случае оборудование не только работает некорректно, но и сильно греется, благодаря чему можно быстро обнаружить проблему;
    • короткое замыкание в фазовой обмотке.

    Еще одна довольно распространенная проблема – это выход из строя регулятора напряжения генератора. Данное устройство устанавливается для того, чтобы нормализовать ток, вырабатываемый агрегатом и подаваемый в бортовую сеть, поддерживать его в строго определенных пределах. Эксплуатация авто со сломанным регулятором категорически запрещается, так как существуют весьма высокие риски выхода из строя всего электрооборудования. Поэтому очень важно своевременно обнаружить проблему и устранить ее.

    голоса

    Рейтинг статьи

    Пропала зарядка на ваз 2112 16 клапанов

    если напруги меньше — проверяй щетки-подкова, если больше — подкова

    и!! ! на инжекторе НАЛЬЗЯ ОТКЛЮЧАТЬ АКБ ПРИ ЗАВЕДЕННОМ ДВИГАТЕЛЕ — СПАЛИШЬ МОЗГИ. !
    (из теории — генератор выдает не ПОСТОЯННЫЕ стабилизированные 12(14) вольт, а пульсирующие — вот эти пульсы и гробят всю электронику. а АКБ все эти пульсации гасит. )

    Если генератор перестал давать зарядку, ничего хорошего в этом нет. Необходимо сразу приступать к поиску причины такой неисправности. В противном случае все ваше электрооборудование окажется без питания, а аккумулятор в скором времени полностью сядет.

    Если генератор работает хорошо, тогда аккумуляторная батарея не будет нуждаться в дополнительной зарядке специальными устройствами в течение многих месяцев, порой даже лет. В АКБ стабильно будет сохраняться минимум 60% заряда. Таким образом, аккумуляторы постоянно восполняют запас заряда за счет работы генератора.

    Внешний вид устройства

    Что стоит на ВАЗ 2110

    Для автомобилей ВАЗ 2110 предусматривается установка двух типов генераторов, в зависимости от установленного двигателя.

    1. Для карбюраторных моделей устанавливается генератор с номером 9402.3701.
    2. Если двигатель инжекторный, тогда каталожный номер используемого генератора будет 3202-3771. Он имеет поликлиновый ремень.

    Вне зависимости от типа установленного двигателя и генератора соответственно, неполадки на устройствах встречаются одни и тех же, потому процедура проверки и ремонта в обоих случаях идентична.

    Неисправности

    Есть две основные причины, из-за которых генератор перестает должным образом обеспечивать зарядку.

    Причина

    Особенности

    Случается такое у тех, кто любит устанавливать многочисленное дополнительное оборудование, которое питание за счет генератора, то есть требует электроэнергии. Это могут быть динамики, электронасосы, видеоустройства и пр. Штатный генератор на такие нагрузки не рассчитан, потому теряет эффективность

    Несоответствие АКБ и генератора

    Чтобы обеспечить работу электрооборудования, дополнительно установленного на автомобиль, многие решают установить более мощную аккумуляторную батарею при штатном генераторе. Несоответствие мощностей приводит к тому, что генератор перестает обеспечивать должную зарядку более мощного аккумулятора. Так ему попросту не хватает для этого ресурсов

    Какой заряд выдает генератор

    Многих интересует вопрос о том, сколько же генератор должен выдавать для нормального функционирования.

    Здесь параметры напрямую зависит от текущего состояния автомобиля.

    • Если двигатель холодный, только включается, тогда напряжение составит в норме 14,1-14,4 Вольт;
    • Если проверять напряжение после длительных поездок в условиях пробок, тогда генератор будет выдавать уже меньше, около 13,9-14,1В.

    Поиск причин неисправностей

    Отсутствие зарядки может быть вызвано широким перечнем причин, о которых мы сегодня поговорим.

    К таковым причинам относят:

    • Слабые контакты;
    • Обрывы обмотки;
    • Замыкание на роторном корпусе;
    • Межвитковые замыкания;
    • Механические поломки;
    • Замыкание зажима плюса на корпусе;
    • Замыкание в фазовой обмотке;
    • Замыкание статора на корпусе.

    Рассмотрим эти ситуации более детально, чтобы определить истинную причину поломки конкретно в вашем случае.

    Начните с того, что отключите все дополнительное оборудование в вашем автомобиле, которое не предусмотрено штатной комплектацией — видеорегистратор, навигатор, аудиосистема и пр.

    Далее выполняем следующие операции.

    1. Измерьте отдачу тока, когда автомобиль холодный, он не работает и все системы жизнеобеспечения отсоединены. Если отдачи совсем не будет, это хорошо. Но происходит это редко. Практически всегда на десятках может быть недостаточный контакт, какое-то замыкание, по причине которого отдача есть, но небольшая. Куда хуже, если отдача внушительная и приводит к разрядке аккумулятора за одну ночь, проведенную на стоянке или в гараже.
    2. Если все в норме, сильных утечек тока нет или они незначительные, а аккумуляторная батарея сохранил свой заряд, тогда можно вернуть все приборы на места, которые были установлены дополнительно.
    3. Проведите повторную проверку отдачи. Если при этом приборы показывают активную утечку тогда, тогда причина кроется не в аккумуляторе, не связана с генератором. Виновником проблемы является одно из устройств, подключенных дополнительно.
    4. Если и при этом отдача не наблюдается, тогда нужно внимательно осмотреть генератор.
    5. Источников неприятностей, которые могут привести к выходу из строя генератора, существует множество. К ним относят:
    • Недостаточный контакт между кольцами ротора и щетками;
    • В обмотке возбуждения произошел обрыв;
    • Возникло межвитковое замыкание на катушке обмотки возбуждения. В таком случае генератор будет гудеть и сильно греться;
    • Обмотка возбуждения замыкает на корпус ротора;
    • Статор замыкает на корпус;
    • Возникает обрыв в фазовой обмотке статора;
    • Пробились диоды в выпрямительном блоке, то есть диодном мосту;
    • Замкнуло плюс на корпусе;
    • Появились механические неисправности.

    Далее мы детальнее рассмотрим каждую из представленных выше причин.

    Разобранный агрегат

    Решение проблем

    1. Слабый контакт. Ослабление контакта может происходить по причине загрязнения, попадания масла на щетки, контактные кольца. Также контакт может ухудшиться из-за усадки пружин, которые давят на щетки, либо зависли щетки. Подобные явления приводят к повышению сопротивления возбуждения и порой способны оборвать цепь. Для устранения проблемы иногда достаточно просто обработать поверхности ветошью, вымоченной в бензине. Если щетки износились, их лучше заменить. Параллельно проверьте состояние пружин, колец. Кольца окисляются, потому обработайте их стеклянной наждачкой.

    1. Оборвалась обмотка. Если это произойдет, пропадет зарядка АКБ. Для определения проблемы положите руку на аккумулятор. При наличии обрыва устройство начнет греться. Если хотите более точную проверку, тогда отключите конец обмотки возбуждения от щетки и подсоедините к нему и зажиму Ш провода АКБ, используя вольтметр или лампочку. При наличии обрыва лампа не загорится, а стрелка вольтметра не сдвинется с места. Проверьте каждую катушку отдельно, чтобы определить, какая из них не дает генератору работать. Внутренние катушки подлежат замене, а внутренние паяются.

    Схема агрегата

    1. Замыкание между витками. Межвитковое замыкание может произойти в любой катушке обмотки возбуждения. Если такая ситуация произошла, обмотка начнет греться, ток возбуждения увеличится. Для проверки обязательно измерьте показатели сопротивления каждой катушки. Для этого вам пригодится вольтметр.

    1. Замыкание на корпусе ротора. Такая поломка приводит к тому, что вся обмотка возбуждения замыкается. Генератор прекращает свою работу. Наиболее распространенным участком замыкания являются места вывода концов обмотки к кольцам ротора. Для проверки используйте лампочку на 220В. Один провод следует подключить к любому контакту кольца, а второй — на сердечник или вал ротора. Если замыкание имеется, тогда лампочка включится. Эксплуатация автомобиля с таким генератором невозможна. Необходимо изолировать или полностью заменить неисправную обмотку. Первый вариант подойдет только для того, чтобы доехать до СТО и провести полноценный ремонт.

    1. Замыкание на фазной обмотке. Такого рода проблема возникает из-за того, что разрушается изоляция, имеющаяся между витками катушки статора. Если это произошло, генератор начнет сильно греться, аккумуляторная батарея не будет получать достаточный заряд, так как это происходит при высоких показателях оборотов коленчатого вала.
    2. Замыкание статора на корпусе. Как и в случае с другими перечисленными вариантами замыкания, в этой ситуации генератор начинает перегреваться, гудеть, его мощность существенно падает. Для проверки вам потребуется лампочка с мощностью 220В. Один провод подключается к сердечнику, а второй — на вывод обмотки. Любой. При наличии замыкания ваша лампочка загорится. Чтобы устранить проблему, достаточно просто заменить вышедшую из строя катушку.
    3. Плюсовой зажим замыкает на корпус. Такая неисправность неприятна тем, что она не просто перегревает ваш генератор. Также из-за данного замыкания происходит пробой диодов выпрямительного блока. Оттуда проблема переходит на аккумуляторную батарею, которую может попросту замкнуть. Не редко замыкание приводило к полному выходу аккумулятора из строя. Хотя чаще всего он просто полностью разряжается.
    4. Механические проблемы. Если принимать во внимание все возможные механические неполадки генератора, тогда на первом месте по частоте будет растяжение ремня. Это наиболее популярная поломка в случае с ВАЗ 2110. Если это произойдет, шкив начнет серьезно перегреваться, у аккумуляторной батареи будет недостаточная зарядка. Не лишним мероприятием является проверка качества всех контактов, наличия обломов соединений и прочих возможных механических проблем.

    При обнаружении проблем с генератором следует незамедлительно приступать к мероприятиям, направленным на устранения поломки. Если опыта нет, обращайтесь исключительно на проверенные станции технического обслуживания.

    Генератор — это сердце электросистемы вашего автомобиля. Словно главный орган человека, он обеспечивает питание всех приборов, устройств. Потому к нему следует относиться очень бережно и при возникновении неполадок не затягивать с ремонтом.

    Генератор Ваз 2112

    Как известно, на Ваз 2112 генератор является достаточно надежным устройством, выдерживающим вибрации двигателя, высокую температуру, воздействие внешней среды и т. д. В Ваз 2112 неисправности генератора обусловлены длительной работой этого устройства, замыканием или другими причинами.
    В Ваз 2112 неисправности на генераторе могут дать о себе знать в самый неподходящий момент.

    Обслуживание генератора в целях профилактики

    Ваз 2112 неисправности в генераторе

    Для начала рассмотрим, как происходит обслуживание генератора:

    • В первую очередь, подразумевается очистка наружных поверхностей.
    • Обслуживание генератора заключается и в проверке крепления устройства к мотору.
    • В тщательной проверке надежности навесного оборудования с генератором и регулятором напряжения.
    • Проверить надо также приводной ремень генератора, ведь в случае слабого натяжения устройство нормально функционировать он не будет. Эту самую проверку рекомендуется проводить каждые 10 тысяч километров пробега.
    • Нужно также проверить состояние ремня генератора, на котором не должно быть никаких трещин или расслоений.

    Ваз 2112 неисправность генератора

    • Проверяется состояние подшипников(см.Замена подшипников генератора на Ваз 2112 своими силами) этого устройства. Данная проверка подразумевает демонтаж ремня и вращение ротора рукой.
      Если в процессе обнаружатся заедания или люфт, а также щелчки или шум – подшипники придется заменять.

    Неисправности генератора на которые следует обратить первоочередное внимание

    Вот и все вышеперечисленные методы проверки состояния генератора Ваз 2112, проводимые в целях профилактики. А теперь перейдем к более подробному анализу неисправностей генератора и узнаем, как их устранять.

    Натяжение ремня генератора

    Ваз 2112 нет зарядки генератора

    Один из самых распространенных видов неисправностей. В идеале этот ремень на Ваз 2112 должен прогибаться всего на 10-15 мм, если речь идет об усилии в 100 H.

    Примечание. Натяжение ремня проверяется специальным индикатором, хотя его отсутствие не проблема. Можно также воспользоваться бытовым безменом – весами, используемыми в хозяйстве. Проверка ремня натяжения своими силами

    • Открываем капот автомобиля.
    • Внимательно осматриваем ремень, так как проблема может быть скрыта не в натяжении, а в обрыве ремня.
    • Нажимаем пальцем на середину ветви, которая расположена между коленвалом и генератором. Как и говорилось выше, можно потянуть крючком ветвь ремня так, чтобы усилие составило 100 H.

    Примечание. Во время проверки натяжени я ремня должна учитываться и марка ремня, а также модель автомобил я.
    Для Ваз 2112 существует отдельная рекомендация завода. Как и говорилось выше, при усилии в 100 H ремень должен прогибаться всего на 8-10 мм.

    • Прогиб измеряется узкой металлической линейкой, которая укладывается сверху на шкивы коленвала и генератора.
    • Если в процессе проверки стало ясно, что ремень генератора расшатан и не отвечает нормам, регулируется его натяжение.

    Ваз 2112 проблемы генератора

    • Регулировка натяжения начинается с того, что ослабляется затяжка всех гаек, размещенных сверху и снизу генератора.
    • Берется ключ и с его помощью коленвал поворачивается всего на два оборота.
    • После этого вновь проверяется натяжение ремня. И если оно ниже нормы, то коленвал поворачивается еще на пару оборотов.

    Когда генератор не дает зарядного тока или дает его незначительно

    Это также распространенная неисправность, связанная с несколькими причинами:

    • Общий обрыв в цепи.
    • Пробуксовка приводного ремня.
    • Зависание щеток генератора.
    • Ротор задевает полюса статора.
    • Оборвалась цепь возбуждения.

    Ваз 2112 генератор греется

    Когда генератор дает ток но нормальный заряд АКБ не обеспечивается, то вэтом случае наблюдаются следующие явления:

    • Витковое замыкание или опять же обрыв цепи из фаз статора.
    • Генератор плохо контактирует с регулятором напряжения, вернее с его массой.
    • Срабатывает реле защиты регулятора напряжения, которое вызвано замыканием в цепи генератора.
    • Проблема с щеткам, которые зависают.
    • Если зависают щетки генератора, то поможет устранить проблему демонтаж генератора, с последующим снятием щеточного узла. Щеткодержатель и щетки очищаются от грязи и пыли, проверяется усилие щеточных пружин.
    • Если подгорают контактные кольца, то их необходимо зачистить или проточить, в зависимости от стадии.
    • Если наблюдается обрыв в цепи, то нужно найти и устранить его.
    • Если ротор задевает за полюса статора, нужно проверить работу подшипников, места их посадки. Поврежденные детали, естественно, нужно будет заменить.
    • Если неисправен регулятор напряжения, то его надо полностью заменить – ремонт не поможет.
    • При плохом контакте генератора с регулятором проверяется целостность провода, который идет на массу и надежность контактов.
    • Если срабатывает реле защиты регулятора напряжения из-за замыкания в цепи, то нужно найти мести и устранить неисправность.
    • Если износились щетки, придется заменить их новыми.
    • Если контактные кольца замаслились или загрязнились, то нужно будет протереть их тканью, смоченной ацетоном.
    • Если неисправен регулятор напряжения, то нужно проверить его и при необходимости заменить на новый.
    • Если наблюдается витковое замыкание или обрыв цепи одной из фаз обмотки, то нужно будет разобрать генератор и проверить состояние обмотки. В случае неисправной обмотки, ее полностью заменяют.
    • При износе подшипников их заменяют.
    • При износе посадочного места подшипников заменяется крышка генератора.
    • При межвитковом замыкании обмотки статора, заменяют статор.

    Контрольная лампа при проверке генератора

    Работоспособность генератора проверяется и при помощи контрольной лампы приборной панели. После включения зажигания лампа двигателя загорается.
    Это позволяет проверить ее работоспособность. Естественно, что после запуска двигателя, лампа должна погаснуть и это будет свидетельствовать о нормальной работе генератора.
    Неисправности генератора, на которые указывает контрольная лампа:

    • Если при работающем двигателе лампа светится в полканала или горит ярко, то это указывает на неисправность. В частности, речь идет о слабом натяжении ремня или же на какое-нибудь нарушение в цепи заряда.
      Возможен в данном случае также полный выход генератора из строя.

    Примечание. Как известно, у нормально функционирующего генератора при средних оборотах двигателя напряжение должно составлять значение от 13,5 до 14,2 В. Величина измеряется вольтметром, путем установки проводов на клеммы аккумулятора.

    В некоторых случаях горящая контрольная лампа на передней панели не всегда свидетельствует о неисправности внутри генератора. Во многих случаях неисправность банальна и лежит на поверхности.
    Вольтметр со шкалой 15 В и более поможет решить проблему.

    • Если напряжение зарядки ниже 12 В, то проверяется ремень натяжения.
    • Если он подтянут нормально, то нужно убедиться в исправности предохранителя под номером 2. Если натянут ремень недостаточно, то подтягиваем и напряжение должно вернуться в норму.
    • Если предохранитель номер 2 исправен, то следует измерить напряжение на выводе. Равняться оно должно напряжению аккумуляторной батареи. Если же предохранитель под номером 2 неисправен, то нужно его заменить и тогда напряжение вернется в норму.
    • Если напряжение на выводе нормальное, придется разбирать генератор – неисправность точно в нем или в реле-регуляторе. Если же напряжение не в норме, то неисправность заключена в сопротивлении приборной панели. В данном случае речь идет либо об обрыве в местах пайки, либо об обрыве провода, который идет к выводу. Находится неисправность и устраняется.
    • После снятия генератора, в случае нормального напряжения на выводе, снимается, в первую очередь, реле-регулятор и проверяется на исправность.
    • Если неисправен реле, то заменяется он на новый. Если исправен, то проверяется обмотка ротора с помощью тестера в режиме омметра.
    • Если сопротивление обмотки меньше значения в 4,5 Ом, то вся обмотка заменяется.
    • Если значение выше 4,5 Ом, то зачищаются контактные кольца. Если значение равно 4,5 Ом, то измеряется сопротивление между выводом “30” и корпусом генератора.
    • Если тестер не показывает обрыв цепи, устраняется замыкание на массу вывода 30.
    • Если тестер показывает обрыв в цепи, проверяется исправность выпрямительного блока.
    • Если выпрямительный блок не исправен, то он заменяется или ремонтируется. Если блок исправен, то проверяется обмотка статора.

    Выше были представлены основные неисправности, которые могут наблюдаться в генераторе. Инструкцию по снятию и разбору генератора своими руками можно посмотреть на этом же сайте в отдельной статье.
    В процессе разбора генератора желательно просмотреть фото и видео – материалы. Цена на новый генератор хорошего качества не такая уж низкая, поэтому отремонтировать его и устранить неисправности будет правильнее.

    Почему нет зарядки аккумулятора? | Ремонт ВАЗ 2109-2108

    Прежде чем написать об основных причинах, по которым на автомобилях ВАЗ 2109-2108 может пропасть зарядка аккумулятора, хотел бы предупредить всех читателей, что приведенный мной перечень не полный и он составлен только исходя из личного опыта эксплуатации. Итак, за свои недолгие 10 лет водительского стажа, машин приходилось эксплуатировать немало и возникало довольно много проблем с зарядкой АКБ, и об основных я постараюсь здесь написать.

    Ни для кого не секрет, что основное устройство, который отвечает за нормальную работу электроприборов в автомобиле, является генератор. Именно из-за выхода из строя некоторых его деталей, зарядка может пропасть полностью, либо же стать слабой. Основные неисправности генератора, которые влекут за собой понижение тока заряда на АКБ:

    • Износ щеток генератора. Это очень частая и наиболее распространенная причина. Если они стерлись до минимально допустимой высоты, то зарядка может пропадать постепенно, а потом исчезнуть и вовсе. Чтобы решить эту проблему, нужно просто заменить щетки новыми и все.
    • Выход из строя диодного моста. Самые надежные диодные мосты обычно стоят на машинах ВАЗ 2109-2108 с завода. И именно они проходят больше всего километров! Это уже проверено не только мной, и любой автоэлектрик со стажем это подтвердит. Если сгорел один из диодов или же полностью весь выпрямительный блок, то его также нужно заменить. Процедура не очень быстрая и приятная, но особого труда не доставит. Чуть ниже кину ссылку на страницу, где описан весь процесс ремонта генератора.
    • Более сложная поломка генератора, такая как обрыв обмотки ротора или статора. Конечно, такое встречается редко, но все же иногда бывает и такое. Стоимость этих запчастей довольно невысока, поэтому лучше купить их новые и установить вместе сгоревших, чем покупать новый генератор.
    • Слабая зарядка может быть из-за проскальзывания ремня генератора. Особенно это становится заметно в сырую или дождливую погоду, или когда на ремень попадает вода. Он начинает свистеть, в следствие чего проскальзывать на шкиве, тем самым не давая генератору набирать достаточные обороты для оптимальной зарядки батареи.

    Если у вас на авто возникли проблемы, которые описаны выше, то все процедуры по обслуживанию можете прочесть здесь: Ремонт генератора на ВАЗ 2109-2108 своими руками. Там все описано довольно подробно и даже для новичков информация будет очень полезной, и разобраться с ней не составит особого труда.

    Конечно, причины пропадания зарядки могут быть еще, и у кого из читателей есть что добавить, просьба отписываться в комментариях, думаю, что информация будет полезной для всех!

    Поменял подшипники на генераторе пропала зарядка — АвтоТоп

    Поменял подшипники на генераторе. Генератор рабочий, просто шумел. После сборки и установки закипел АКБ. До этого всё работало нормально.

    • Быстро садиться аккумулятор, ВАЗ 2110 – 9 ответов
    • Проверка заряда АКБ от генератора в ВАЗ 2110 – 5 ответов
    • Глохнет при включении печки ВАЗ 2110 – 3 ответа
    • На генераторе возбуждение есть, а тока нет, ВАЗ 2110 – 3 ответа
    • Начала быстро разряжаться АКБ на ВАЗ 2110 – 2 ответа

    Что-то напортачили при ремонте. А может просто совпадение. По хорошему надо бы снять генератор и разобрать для проверки.

    Целостность обмотки якоря проверьте, не оборвались ли провода на контактных кольцах и нет ли замыкания на сам якорь. Пока подшипник стягивали могли и кольца потянуть, а чтоб проводок оторвался от лепестков большого усилия не нужно.

    А вообще то нужно было сперва напряжение проверить и как оно изменяется при увеличении оборотов двигателя.

    Подпишись на наш канал в Я ндекс.Дзене

    Еще больше полезных советов в удобном формате

    Быстро садиться аккумулятор, ВАЗ 2110

    На генераторе возбуждение есть, а тока нет, ВАЗ 2110

    Проверка заряда АКБ от генератора в ВАЗ 2110

    Всем привет, в этой записи я подробно расскажу про замену контактных колец и подшипников генератора. Стоят эти детали немного, зато после замены получаем практически нового гену!

    Нам понадобится:
    Подшипник генератора передний 303, я приобрел вологодский VBF(ВПЗ-23) — 90р
    Подшипник генератора задний 202, я приобрел вологодский VBF(ВПЗ-23) — 70р
    Контакные кольца, они же коллектор ротора генератора — 100р
    Также необходимо купить новый регулятор напряжения — 130р
    Рекомендую заводской «Автоэлектроника» или «Орбита», я же приобретать его не стал, так как, длина щеток старого регулятора еще достаточная.

    Еще мне понадобились:
    Планка натяжная генератора 2110 — 30р
    Ремкомплект гайки шкива генератора 50р (гайка+плоская шайба+шайба гровера+упорная шайба), мне нужна была только гайка.

    В зависимости от года выпуска, генератор бывает старого и новового образца. Разница только в диаметре вала, у старого — 15мм, у нового 17мм
    Для вала диаметром 15мм нужен подшипник 302 он же 6302.RS
    Для вала диаметром 17мм нужен подшипник 303 он же 6303.RS
    Задний подшипник у всех генераторов одинаковый — 202 маркировка 6202.RS

    Большинство генераторов нового образца, с валом 17мм, мой тоже оказался нового.
    Интересно, что с завода были установлены подшипники SKF France, а не российского производства. Генератор кстати 2002года)

    А началось все с появления жуткого гула со стороны двигателя, моего терпения хватило ровно на одну поездку, но в любом случае затягивать с ремонтом гены не стоит, так как изношенный подшипник может заклинить. Приехал в гараж, открыл капот, скинул ремень с гены и завел, звук пропал. Снял гену, здесь подробно останавливаться не буду, все подробно расписано тут. Выносим гену на свет, и с умным видом вертим в руках, как надоест, приступаем к разборке, бла бла бла, снимаем
    пластиковую крышку
    диодный мост
    регулятор напряжения(щетки)
    зажимаем шкив в тисках через резиновые прокладки(чтоб не повредить его) и откручиваем гайку шкива(головка на 24)
    затем маркируем взаимное расположение крышек генератора, откручиваем четыре стяжных винта, затянуты они хорошо, а сделаны из достаточно мягкого металла, поэтому откручиваем либо ударной отверткой, либо обычной крестовой, но с большим жалом, предварительно пролив вэдэшкой или тормозухой.
    Затем также проливаем место стыка крышек вэдэшкой или тормозухой, и половиним корпус гены, с помощью отвертки или монтажной лопатки.

    И тут начинается самое интересное! Якорь(ротор) генератора запресован в подшипник, а подшипник запресован в крышку, нам нужно выбить ротор, но сделать это нужно аккуратно, не повредив вал. Для этого накручиваем гайку на конец вала и через деревяшку ударами молотка выпрессовываем вал из подшипника. Я ударял без деревяшки и подпортил гайку, пришлось купить ремкомплект за 50р (гайка+плоская шайба+шайба гровера+упорная шайба) из него я взял только гайку.

    Затем берем переднюю крышку из которой только, что выпрессовали ротор, и с помощью трубы или подходящей головки аккуратно выбиваем подшипник. Подшипник в крышке завальцован, и при снятии подшипника завальцовка частично обломится, но в моем случае это не помешало новому подшипнику плотно запрессоваться в крышке.

    Хорошенько моем крышки с помощью, воды, чистящего средства, щетки и абразива(обычный песочек или кусочек наждачки).

    Получаем эстетическое удовольствие от чистых крышек и используя старый подшипник как оправку запресовываем новый, при этом главное не допустить перекоса подшипника. Кстати! если нет желания возиться с выпрессовкой-запрессовкой подшипника, можно купить переднюю крышку в сборе с подшипником, обойдется она в 250р против 90 за подшипник

    Мы же, решили не искать легких путей и приобрели новые контактные кольца за 100р) Особенно, если учесть, что выбора-то у меня небыло, так как старые я сразу варварски снял, зажав в тисках и провернув ротор.

    Но прежде, чем заменить контактные кольца необходимо снять задний подшипник генератора. При снятии заднего подшипника, я ни в коем случае не рекомендую использовать съемник, так как диаметр вала небольшой и его легко можно повредить съемником.

    Богдан74
    Участник

    Всем привет! Кто что знает, выручайте! Авто Ford Explorer Sport Trac

    Случилось следующее: неделю назад заморгала лампочка зарядки аккумулятора.

    Ясное дело генератор, подумал я, но не тут то было!

    Дотянув до дома, скинул генератор, отвёз в ремонт. Там заменили ротор, подшипники и реле регуляторов. Проверили работает. Ставлю на место его и. о чудо лампочка не то чтобы моргать она даже тухнуть перестала. Сегодня на разборе воткнул другой генератор-такая же фигня-ЗАРЯДКИ НЕТ.
    Вопрос-что ещё кроме генератора влияет на подзарядку аккумулятора?

    Замена реле зарядки ВАЗ 2110

    Нет зарядки на ВАЗ 2107 причины устранение.

    Пропала зарядка.

    Тюнинг зажигания инжектор ваз 21.

    Где стоит реле зарядки на ваз 2109.

    Схема дополнительного реле стартера ваз 2110.

    Замена реле и щёток генератора.

    Где находится стартёр на ваз 2115 фото.

    Связь стартера с реле.

    Методика проверки реле регулятора ВАЗ.

    Лада Приора (Lada Priora Club).

    Реле регулятор на генераторе.

    Запчасти ВАЗ передний привод.

    Замена регулятора напряжения.

    10. Просмотров. змейка реле старте. b Электросхема ваз 2110 инжектор.

    Как подключить регулятор реле зарядки ВАЗ — на Tuning-Vazov.ru.

    Ваз 2110 низкое напряжение генератора.

    Доработка реле регулятора напряжения ваз 2110.

    Где находится регулятор напряжения ВАЗ 2106.

    Зарядка аккумулятора 15 вольт что делать. Правильная зарядка автомобильного аккумулятора. Зарядка постоянным напряжением

    Напряжение аккумуляторной батареи автомобиля является опережающим показателем, на основании которого грамотный водитель должен делать выводы о состоянии аккумуляторной батареи, нуждается ли она в зарядке или замене. Известно, что существует прямая зависимость напряжения от уровня заряда автомобильного аккумулятора. Сначала рассмотрим вопрос о том, по каким показателям напряжения можно сделать вывод о том, что аккумулятор исправен, почему аккумулятор теряет U и что означает показатель напряжения.После этого попробуем определить заряд аккумулятора по напряжению: в конце статьи будет приложена таблица, на основании которой делаются определенные выводы о состоянии аккумулятора.

    Аккумулятор теряет напряжение: в чем причина?

    Если заряженный источник питания быстро разряжается, причин такого «поведения» аккумулятора может быть несколько. Уровень заряда аккумулятора может быстро упасть по естественной причине: аккумулятор просто исчерпал свой ресурс в обычном режиме и нуждается в подзарядке.

    Также может выйти из строя генератор переменного тока, который заряжает аккумулятор во время езды, помогая ему поддерживать требуемый уровень рабочего состояния. Если аккумулятор еще не старый, а генератор в порядке, вероятно, у автомобиля серьезные проблемы с током в виде его постоянной утечки.

    Кроме того, неисправна может быть бортовая сеть автомобиля — например, магнитола или какой-то другой прибор берет слишком большой ток, и аккумулятор просто не справляется с такой нагрузкой.

    Для устранения падения напряжения иногда достаточно устранить проблему путем технического осмотра, выявления причины, ее устранения и повторного измерения напряжения на клеммах аккумулятора через несколько часов его работы. Важно оценить такие показатели, как уровень, а также измерить напряжение под нагрузкой и без нее.

    Что означает нормальное напряжение батареи?

    Для нормальной работы аккумулятора его напряжение должно колебаться в пределах 12.6-12,7 вольт, не меньше. Эту норму следует выучить начинающим водителям, как таблицу умножения – чтобы не пропустить критический уровень разряда аккумулятора и не оказаться в положении, когда машина вдруг «встанет».

    Также следует знать, что в зависимости от характеристик аккумулятора и автомобиля, а также других сопутствующих условий, показатель может меняться — до 13 вольт и чуть выше. Так утверждают некоторые производители аккумуляторов, и этот фактор тоже нужно учитывать.Сколько вольт должно быть в идеале, это относительная цифра. Но всегда нужно ориентироваться на показания от 12,6 до 13,3 вольта — в зависимости от типа и страны производства аккумулятора.

    При падении напряжения аккумулятора ниже 12 вольт он как минимум наполовину разряжен, а при падении ниже 11,6 вольт аккумулятор необходимо срочно зарядить.

    Итак, норма показателя напряжения большинства автомобильных аккумуляторов составляет от 12,6 до 12,7 вольт, а если используется нестандартная модель аккумулятора, норма U может быть несколько выше: 13 вольт, но максимум 13.3. Некоторые начинающие автомобилисты задаются вопросом, каким должен быть в идеале показатель U. Конечно, идеальных цифр не бывает, так как может меняться текущий уровень в сети авто, погодные условия, энергопотребление. отдельные элементы бортовой сети автомобиля.

    Чтобы не пропустить момент, когда заряд батареи начинает падать до критического уровня, существует так называемая таблица заряда батареи. Если вы измеряли U на выводах своего аккумулятора, то можете определить заряд аккумулятора по напряжению: в этом вам поможет сориентироваться таблица.Он отображает прямо пропорциональную зависимость U от уровня заряда аккумулятора в процентах.

    В таблице также указана плотность электролита и температура, при которой он может замерзнуть в холодное время года — также в зависимости от уровня заряда и U в аккумуляторе.

    Таблица уровня заряда аккумуляторов

    Плотность электролита, г/см³ Напряжение (напряжение) без нагрузки Напряжение (напряжение) под нагрузкой 100 ампер Уровень заряда батареи, % Температура замерзания электролита, °С
    1,11 11,7 8,4 0 -7
    1,12 11,76 8,54 6 -8
    1,13 11,82 8,68 12,56 -9
    1,14 11,88 8,84 19 -11
    1,15 11,94 9 25 -13
    1,16 12 9,14 31 -14
    1,17 12,06 9,3 37,5 -16
    1,18 12,12 9,46 44 -18
    1,19 12,18 9,6 50 -24
    1,2 12,24 9,74 56 -27
    1,21 12,3 9,9 62,5 -32
    1,22 12,36 10,06 69 -37
    1,23 12,42 10,2 75 -42
    1,24 12,48 10,34 81 -46
    1,25 12,54 10,5 87,5 -50
    1,26 12,6 10,66 94 -55
    1,27 12,66 10,8 100 -60
    Ближе к концу осени у автолюбителей часто возникает вопрос о качественной зарядке аккумулятора.Как это сделать, чтобы добиться наилучшего результата?

    Свинцовые аккумуляторы заряжаются от источника «выпрямленного» (постоянного) тока. Для этого подойдет любое устройство, позволяющее регулировать зарядный ток или напряжение, при условии, что оно обеспечивает увеличение зарядного напряжения до 16,0-16,5 вольт. В противном случае полностью зарядить современную 12-вольтовую батарею, до 100 процентов ее емкости, не получится.

    Для зарядки положительная клемма зарядного устройства подключается к (+) клемме аккумулятора, а отрицательная клемма к (-) клемме.

    Существует два режима зарядки: режим постоянного тока и режим постоянного напряжения. По влиянию на срок службы батареи эти режимы эквивалентны.

    Зарядка в режиме постоянного тока.

    Аккумулятор заряжается током, который составляет одну десятую от номинальной емкости для двадцатичасового разряда. То есть для аккумулятора емкостью 60 А/ч (ампер в час) нужен зарядный ток 6А. Недостатком этого режима зарядки является необходимость многократного (каждые 1-2 часа) контроля силы тока и его регулирования, а также сильное выделение газов в конце процесса.

    Для снижения газовыделения и обеспечения более полного заряда аккумулятора полезно применять постепенное уменьшение силы тока по мере увеличения зарядного напряжения. При достижении напряжения 14,4 вольта ток заряда необходимо уменьшить вдвое до 3 ампер (для аккумулятора емкостью 60 А/ч) и продолжать заряд до начала газовыделения.

    В современных аккумуляторах, не оборудованных отверстиями для доливки воды, после повышения зарядного напряжения до 15 вольт полезно еще раз уменьшить зарядный ток вдвое — до 1.5 ампер (для аккумулятора емкостью 60 А/ч).

    У так называемых необслуживаемых аккумуляторов состояние полного заряда наступает при значении напряжения 16,3-16,4 вольта (разница зависит от качества электролита и состава сплавов, из которых изготовлены сетки).

    Зарядка в режиме постоянного напряжения.

    При использовании этого метода уровень заряда аккумулятора в конце процесса зависит от величины зарядного напряжения, подаваемого зарядным устройством.Так после непрерывной 24-часовой зарядки при значении напряжения 14,4 вольта 12-вольтовая батарея зарядится до 75-85% своей емкости, при значении напряжения 15 вольт — до 85-90%, а при 16 вольт — до 95-97 %. Полностью в течение 20-24 часов. Аккумулятор заряжается при подаче на него напряжения 16,3-16,4 вольта.

    В зависимости от емкости и внутреннего сопротивления аккумулятора в момент заряда проходящий через него ток может превышать 50 ампер. Поэтому во избежание его выхода из строя в зарядных устройствах предусмотрено ограничение максимального тока до 20-25 ампер.

    Во время зарядки напряжение на клеммах аккумулятора постепенно достигает напряжения зарядного устройства, а ток заряда снижается практически до нуля (при условии, что напряжение зарядки меньше напряжения, при котором начинается газовыделение). Таким образом, зарядку можно производить без постоянного внимания человека. Показателем окончания зарядки здесь является повышение напряжения на клеммах аккумулятора до 14,3-14,5 вольт. В это время обычно включается зеленый световой сигнал, обозначающий момент достижения необходимого напряжения и завершения процесса зарядки.

    На практике нормальная зарядка (до 90-95% емкости) необслуживаемых аккумуляторов современными зарядными устройствами с максимальным напряжением 14,4-14,5 вольт обычно занимает более суток.

    Зарядка автомобильного аккумулятора.

    В автомобиле аккумулятор заряжается в режиме постоянного напряжения при работающем двигателе. По договоренности с производителями аккумуляторов автопроизводители устанавливают зарядное напряжение в генераторах на уровне 13,8-14,3 вольта — меньше напряжения, при котором происходит интенсивное газовыделение.

    При понижении температуры воздуха увеличивается внутреннее сопротивление аккумулятора, из-за чего снижается эффективность его зарядки в режиме постоянного напряжения. По этой причине не всегда удается полностью зарядить аккумулятор в автомобиле, а зимой при напряжении на клеммах 13,9-14,3 вольта и включенном дальнем свете заряд аккумулятора не превышает 70-75 В. %. В связи с этим зимой, в условиях низких температур, коротких пробегов и частых пусков холодного двигателя полезно не реже одного раза в месяц заряжать аккумулятор в помещении с помощью зарядного устройства.

    Контроль плотности электролита.

    Для свежезаряженного аккумулятора плотность электролита в каждой банке должна быть в пределах 1,27-1,29 г/см 3 . По мере расходования заряда плотность постепенно снижается и для полуразряженного аккумулятора она составляет 1,19-1,21 г/см 3 . При полной разрядке плотность электролита достигает 1,09-1,11 г/см 3 .

    В нормально заряженной батарее, не имеющей внутренних коротких замыканий, плотность электролита во всех банках примерно одинакова с расхождением не более 0.02 г/см 3 . При возникновении внутреннего замыкания в какой-либо из банок плотность электролита в ней будет ниже, чем в остальных, на 0,10-0,15 г/см 3 .

    Плотность электролитов и других жидкостей измеряется с помощью устройства, называемого ареометром. Для различных жидкостей ареометр имеет сменные плотномеры (от латинского слова densum — плотность, густота, вязкость).

    При измерении плотности ареометр следует по возможности держать так, чтобы поплавок не касался стенки трубки.При этом измеряется температура электролита, а плотность рассчитывается исходя из того, что его температура составляет +25°С. Для этого показание ареометра увеличивают или уменьшают на величину, которая берется из таблицы, приведенной в соответствующей специальной литературе.

    КЛИМАТ И СЕЗОН В ИЗМЕРЕНИИ
    ПЛОТНОСТЬ ЭЛЕКТРОЛИТА
    ПЛОТНОСТЬ (г/см 3)
    Аккумулятор заряжен Аккумулятор разряжен
    на 25% на 50%
    Очень холодный (температура января от -50°С до -30°С) ЗИМА 1,30 1,26 1,22
    ЛЕТО 1,28 1,24 1,20
    Холодный (температура января от -30°С до -15°С) 1,28 1,24 1,20
    Умеренная (температура января от -15°С до -8°С) 1,28 1,24 1,20
    теплый влажный (температура января от 0°С до +4°С) 1,23 1,19 1,15
    сухое горячее (температура января от -15°С до +4°С) 1,23 1,19 1,15

    Если напряжение рабочего цикла на аккумуляторе меньше 12 В.6 вольт, а плотность электролита менее 1,24 г/см 3 , следует проверить напряжение на клеммах при работающем двигателе и поставить аккумулятор на зарядку.

    Регулярно выполняя эти нехитрые действия, можно добиться долговременной и безотказной работы аккумулятора в любое время года.

    Разряженный аккумулятор не всегда требует покупки нового, часто достаточно зарядить старый, процедура неизбежна при частых холодных пусках и коротких поездках.Самые доступные зарядные устройства имеют ручное управление, владелец должен знать, каким напряжением заряжать автомобильный аккумулятор.

    Требуется постоянный ток, напряжение до 16,5 вольт. Зарядка происходит в одном из двух режимов: постоянным током или постоянным напряжением.

    Зарядное устройство Bosch

    Зарядное устройство настроено на ток, равный 10% от номинальной емкости. Например, для аккумулятора 12 Вольт емкостью 55Ач требуется ток 5,5А, для 60Ач — 6А.Силу тока при этом необходимо регулярно контролировать и регулировать, так как она имеет свойство сбиваться.

    При поддержании силы тока на уровне 10% в конце процесса зарядки происходит сильное газовыделение. Поэтому при достижении 14,4 вольт сила тока снижается в 2 раза. Для необслуживаемых аккумуляторов оно снова уменьшается вдвое, когда напряжение показывает 15 вольт.

    Узнайте время зарядки аккумулятора

    Автомобильный аккумулятор 12 В заряжен, когда напряжение и ток в нем не меняются в течение 2 часов.Для полноценной работы достаточно сохранения параметров в течение 1 часа. Обычно это происходит при 16,3 (± 0,1) Вольта.

    Зарядка с сохранением напряжения

    Аккумулятор 12 Вольт в день будет заряжаться:

    Для сильно разряженного аккумулятора сила тока в начале заряда может достигать высоких значений, что может привести к выходу из строя аккумулятора, поэтому показатель ограничен 20А.

    По мере зарядки ток уменьшается, и в итоге стремится к нулю.Этот метод не требует постоянного контроля со стороны владельца. Контролировать процесс можно через сутки после старта, замерив какое напряжение на клеммах. Если оно составляет 14,4 (±0,1) В, зарядка завершена. Необслуживаемым батареям обычно требуется больше суток, чтобы достичь этой цифры. На устройствах, оснащенных индикацией, загорится сигнал, указывающий на окончание.

    Зарядка кальциевых аккумуляторов

    Старые сухозаряженные аккумуляторы заряжаются током 10%, для них допустимо напряжение до 16 вольт.Аккумуляторы 12 Вольт Са/Са нового типа быстро выходят из строя от такого высокого напряжения.

    Максимально допустимое значение для них 14,4 вольта при токе 10% от емкости. Такая зарядка требует больше времени, но не сокращает срок службы аккумулятора.

    Зарядка аккумуляторов 6 Вольт

    Аккумуляторы 6 В часто используются в:

    • мотоциклы, мотороллеры;
    • лодок;
    • торговое, складское, промышленное оборудование;
    • детских автомобилей;
    • инвалидных колясок.

    Учитывая широкое использование 6-вольтовых батарей, они доступны в широком диапазоне емкостей, они могут иметь как 1,2 Ач, так и 16 Ач, или любую промежуточную величину. Зарядить такие аккумуляторы автомобильным зарядным устройством проблематично. Потребуется тщательный контроль, постоянная регулировка тока. Велик риск перегрева.

    Наиболее подходящим зарядным устройством для 6-вольтовой батареи является зарядное устройство Imax B6 или подобное. Ток 10% от емкости, напряжение до 7,3В.

    Зарядка литий-полимерных аккумуляторов

    Липо 3.8 В заряжаются устройствами, которые идут в комплекте, или зарядными устройствами типа Imax B6.

    Аккумуляторы заряжаются током от 20 до 100% номинальной емкости. Для аккумуляторов предпочтительнее меньшие значения. Главный вопрос, какое напряжение показывает заряженный аккумулятор? После набора 70-80% начинается зарядка при постоянном напряжении и уменьшающемся токе.

    Специальные устройства для Lipo 3,8 В сигнализируют об окончании зарядки при достижении 70-80% емкости. Дальнейшее увеличение плотности обеспечивает более редкие зарядки, но снижает срок службы батареи в целом.

    При зарядке литий-полимерных аккумуляторов на 3,8 В зарядное устройство должно показывать 4,2 В. Если вы можете установить 4,1 Вольта, зарядка займет немного больше времени, но батарея прослужит намного дольше.

    Зарядка аккумулятора без демонтажа с автомобиля

    Описанные выше методы включают зарядку от настенной розетки, что обычно требует извлечения аккумулятора. Однако зарядка может происходить и под капотом. Современные портативные устройства, такие как CTEK, имеют компактные размеры, что позволяет заряжать аккумулятор на 12 В под крышкой.Их можно оставить на ночь, чтобы утром батарея была в рабочем состоянии. Такие зарядные устройства особенно актуальны для владельцев автомобилей с кальциевыми аккумуляторами.

    Подзарядка аккумулятора генератором

    Для автомобилей с двигателем внутреннего сгорания Аккумулятор работает в паре с генератором. Во время движения генератор подзаряжает аккумулятор, который впоследствии дает заряд для запуска автомобиля.

    Если емкость аккумулятора превышает рекомендуемую, то зарядка от штатного генератора займет гораздо больше времени.Часто в таких случаях аккумулятор не успевает зарядиться до нужного уровня, начинает быстро разряжаться вплоть до глубоких разрядов.

    При установке аккумулятора емкостью меньше рекомендуемой, ток генератора для него оказывается слишком большим, он быстро перегревается, может закипеть.

    Срок службы батареи в обоих описанных случаях резко сокращается.

    Какое напряжение должен показывать заряженный аккумулятор, во многом зависит от его типа. Мы подробно рассмотрели основные из них.Бережная зарядка продлевает срок службы батареи. При своевременном уходе они могут прослужить до 5 лет и более.

    Вы наверное заметили, что в последнее время я часто пишу про автомобильные аккумуляторы, только что открыла новый раздел на сайте и хочу осветить все «горячие вопросы» — много полезного прочитала. Еще одна очень животрепещущая тема — перезаряд батареи, сегодня я постараюсь рассказать, какие могут быть причины, а также последствия этого явления, почему перезарядка батареи так же плоха, как и ее «недозарядка».Подробнее…

    Я уже не раз указывал, что в аккумуляторе небольшое количество электролита, у каждой модели все зависит от мощности по разному. Именно этот электролит способствует накоплению энергии, без него не было бы эффекта батареи (аккумулятора). Но ведь эта жидкость очень капризна, ей нужно создать необходимые условия – чтобы она не замерзла, а также чтобы она не выкипела. Если , то «закипание» аккумулятора может быть спровоцировано перезарядкой, а это уже серьезно.Что-то нужно сделать.

    Что такое перезарядка?

    Если объяснить на пальцах, то это достаточно простой процесс — уже заряженная батарея, генератор продолжает заряжать и заряжать. В составе электролита есть доля воды, причем довольно большое количество около 65% (остальное в составе серная кислота 35%), в нормальных условиях батарея набирает заряд (повышает плотность до нужной уровень) и выключается, так что его напряжение равно 12.7 Вольт, это среднее значение 100% напряжения для многих аккумуляторов.

    Если продолжать заряжать батарею дальше, то вода внутри электролита начнет разлагаться на составляющие ее газы, а это водород и кислород — электролит закипит или закипит, соответственно уровень воды упадет (испарится) — чем больший ток подаешь, тем интенсивнее он будет — это классическая подзарядка аккумулятора.

    Сопровождается интенсивным кипением и снижением уровня электролита.На самом деле такое явление гораздо опаснее, чем, скажем, «недозарядка».

    Если аккумулятор заряжен не полностью, вы просто не заведете свою машину, а при перезаряде аккумулятор может просто взорваться.

    Причины этого явления

    Ребят, скажу пару слов о «специальной» подзарядке от зарядного устройства — многие делают это специально! ЗАПОМНИТЬ! Таким образом — до нужного уровня — в нашем диапазоне это примерно 1,27 г/см 3 , если плотность ниже (уже с заряженным аккумулятором), то аккумулятор может зависнуть на минусовых значениях.Нам нужно его поднять! Но как это сделать? Очень просто — нужно выпарить из электролита небольшое количество воды, так увеличится концентрация кислоты и увеличится плотность.

    Поэтому многие автолюбители «кипятят» АКБ малым током, от зарядного устройства, но только до определенного значения плотности. После этого зарядка отключается. В противном случае просто «угробить» батарею. Особенно важно – не допустить «оголения» пластин.

    Теперь о «неспециальной» подзарядке, как говорится под капотом автомобиля, ее основные причины:

    • Неисправное реле регулятора заряда генератора . Это реле «видит» зарядку, и при достижении 12,7 Вольт отключает питание от генератора. Если это реле выйдет из строя, то генератор будет постоянно заряжать аккумулятор, а его токи немалые, закипит очень быстро! Это самая распространенная причина. К счастью, это реле стоит копейки.Коротенькое видео, смотрите.
    • Генератор вышел из строя , такое тоже бывает. Например, поменяли реле, но ничего не помогает, постоянно заряжаются! Нужно ремонтировать или менять генератор, тут ремонт уже сложнее и дороже.

    • НА некоторых автомобилях, например, грузовиках, также на некоторых УАЗ, стоит вольтметр , он показывает напряжение от генератора до аккумулятора, то есть как он его подзаряжает.Обычно оно не должно превышать 14 Вольт, но часто показания составляют 15 — 17 Вольт, что очень много. У меня на практике был такой случай — поменяли и реле и генератор, все новое, а вольтметр показывает 17 Вольт, уже голову сломали, что делать! Оказывается вышел из строя сам датчик, поменяли этот дисплей и все нормально, напряжение выровнялось на 14 вольтах. Так что мораль такова — иногда сам датчик выходит из строя — перезарядки нет, просто показывает «ложные» показания.

    Это самые распространенные причины почему заряд выходит за норму, по сути ломаться больше нечему, если у вас не какой-то лексус в котором просто много датчиков, может быть еще что-то, хотя мне кажется, что вряд ли есть.

    К счастью, в новых автомобилях загорятся два индикатора на панели, этот, а также значок аккумулятора.

    Многие скажут — ну и что, перезагружается, и «привет» с ним, что будет? Но ребята не рассказывайте, мы читаем о последствиях.

    Последствия перезарядки

    Итак, для тех, кто считает, что все это несерьезно и с этим можно ездить, посвящается, разобью по пунктам:

    • При перезарядке электролит закипает, он выплескивается на поверхность аккумулятора, а затем течет на многие детали под капотом, например: — клеммы, патрубки, металл кузова, радиатор, провода и т.д. Так как здесь присутствует кислота (пусть и не концентрированный), но все же он может разъедать все, что я вам перечислил, пусть и не сразу, но сделает.

    • Терминальное окисление. Так как кислота попадет на клеммы, они очень быстро окислятся, появится зеленый налет.

    • Уровень электролита падает, обнажаются свинцовые пластины, а зарядка продолжается! Таким образом, они будут нагреваться, что на них негативно влияет – если их долго не размораживать, то они «рассыплются», банки могут закрыться, либо батарея вообще сдохнет. Просто выньте аккумулятор.
    • Так как электролит испаряется, а это по сути взрывоопасные газы (кислород и водород), то и сама батарея может взорваться, а так мало не покажется.Весь моторный отсек будет в кислоте.

    Все о ДГМВ ВАЗ-2110 (ДМРВ)

    ДМРВ ВАЗ-2110 (датчик массового расхода воздуха) – важнейшая деталь автомобиля, без которой не обходится ни один современный инжекторный двигатель, в том числе и отечественный двигатель «десятки». Многие автовладельцы хоть раз сталкивались с проблемой ДВС. Во многих случаях причиной является неисправный датчик массового расхода воздуха. Сегодня мы поговорим о его конструкции, а также выясним, можно ли отремонтировать эту деталь в случае поломки.

    Что такое датчик воздуха?

    ВАЗ-2110 и многие другие модели «десятого семейства» имеют схожую конструкцию ДМРВ. В основном эта запчасть представляет собой небольшое устройство, которое устанавливается в форсунку и соединяет дроссельную заслонку с воздушным фильтром (отсюда и название — датчик воздуха). Его основная функция заключается в контроле объема воздуха, поступающего в двигатель форсунки.

    Как определить неисправность этой детали?

    Основным признаком неисправности датчика массового расхода воздуха является неравномерная работа двигателя.При его работе водитель чувствует резкие скачки оборотов, неправильную динамику разгона и перебои на холостом ходу. Также при поломке этой детали машину очень сложно завести: даже если на улице плюс 30, в салоне жара и двигатель горячий, на такой машине вряд ли получится куда-то уехать.

    Существуют и другие признаки, свидетельствующие о том, что ДМРВ В-2110 пришел в негодность, и они могут возникать даже при нормальной разгонной динамике автомобиля. Об этом может сигнализировать треснувший шланг, соединяющий дроссельный модуль с расходомером.И последнее, что сигнализирует о неисправности, это светящаяся лампочка на панели приборов («Check engine» или CHECK ENGINE). Но такой сигнал не дает 100-процентной гарантии, что неисправность следует искать в датчике массового расхода воздуха. Возможно, неисправность кроется в лямбда-зонде или какой-то другой детали. Поэтому в любом случае машину нужно отправить на диагностику, иначе по лампочке точную причину поломки не определить.

    Можно ли починить?

    К сожалению, эта деталь не подлежит ремонту.В случае поломки его можно только заменить. Кроме того, ДМРВ ВФД-2110 очень уязвимое устройство: его можно сломать даже при частой чистке его поверхности (особенно часто при чистке устройства ватой).

    Замена ресурса

    Точно, через сколько надо заменить ДМРВ, нельзя — он может сломаться и через 10 тысяч километров, а может прослужить 100 тысяч и более. Все зависит от конкретных условий эксплуатации и от качества сборки самой детали.

    Датчик ДМРВ ВАЗ-2110: цена

    В среднем стоимость новой запчасти для «десятки» составляет около двух тысяч рублей. А вот в магазинах можно увидеть детали с гораздо меньшей стоимостью. Как правило, это датчики без корпуса. Но покупать их ради экономии не стоит, так как такая запчасть может вскоре сломаться. Также возможно, что такой ДМРВ просто не подойдет вашему железному другу.

    Схема подключения прикуривателя ВАЗ 2110.Прикуриватель не работает. Возможные причины и их устранение. Автомобильная розетка для электроприборов

    Когда инженеры впервые оснастили автомобиль этим устройством, они надеялись, что водители будут использовать его по прямому назначению, то есть прикуривать сигареты. Но особой популярностью устройство не стало. Многие курильщики предпочитают использовать спички или любимую зажигалку.

    Дизайнеры уже начали думать о том, чтобы вообще убрать устройство.

    Но вскоре зажигалка обрела вторую жизнь. Со временем каждый человек стал иметь большое количество различных электронных и электрических устройств. Естественно, электронике для работы требовалось электричество.

    Из истории прикуривателя

    Сегодня уже сложно вспомнить первую марку автомобиля, в которой эта опция была стандартной. Есть информация, что это было в 20-х гг. Конструкция этого первого устройства была довольно примитивной. Картридж был внутри катушки.Когда его вытаскивали из гнезда, это замыкало цепь, и картридж нагревался. Уже тогда водители сталкивались с тем, что прикуриватель не работает на автомобилях после длительного или неаккуратного использования.

    1924 год стал знаковым для этого небольшого, но такого полезного устройства. В этом году прикуриватель получил дизайн, который сегодня знают все. Также в этом году он был запатентован. А вот в автомобилях устройство получило свое место только в 50-х годах. Это одно из устройств, которое не испытало влияния современных технологий.

    Как устроен и работает прикуриватель?

    Металлический картридж с удобной ручкой в ​​виде кнопки. В патроне установлена ​​специальная нихромовая спираль. На приборных панелях есть специальные розетки. Если в это гнездо вставить прикуриватель и закрепить его там, то он будет подключен к электрической сети автомобиля.

    Плюсовой контакт соединен с центральным контактом розетки и спирали. «Масса» подается на основание раструба.

    Через нихромовую спираль проходит электричество, в результате чего она нагревается до красного цвета. В момент превышения температурной неисправности устройство отключится с помощью теплового реле. В этом случае водитель услышит специальный звуковой сигнал.

    Казалось бы, почему не работает прикуриватель? Ведь его конструкция предельно понятна и проста.

    Розетка защищена предохранителем на 10 А и находится в блоке предохранителей.Блок можно найти в разных местах. Это зависит от марки и модели автомобиля.

    Плюсы и минусы устройства

    Главный и самый «жирный» плюс в том, что к розетке можно подключить много электроники, даже мини-чайники, компрессоры и многое другое.

    А минус, как думают многие, это ненадежная коммутация больших токов. Современные приборы имеют силу тока более 40 А. Здесь существует зависимость: чем больше сила тока в цепи, тем выше надежность электрических соединений.Это одна из причин, почему не работает прикуриватель.

    Здесь было бы здорово повысить надежность фиксации вилки в розетке, но стандарт для такого типа подключения не разработан. В вилке можно найти только один центральный контакт, который фиксируется пружинкой, а также две ножки, осуществляющие прижим. Зона положительного контакта может быть спрятана очень глубоко. Из-за качества наших дорог при проезде ям и неровностей может пропадать электрический контакт между вилкой и розеткой.Некоторые водители даже наблюдали искрение между контактами. Это риск короткого замыкания и даже возгорания.

    Не работает прикуриватель: причины

    Иногда выходит из строя этот важный и нужный прибор. Это может быть связано и с конструкцией, и с блоком предохранителей, и даже с перегоранием подсветки.

    Часто прикуриватель выходит из строя именно из-за предохранителя. Причина этого в электроприборах, которые подключаются к розетке. Дело здесь в том, что это гнездо не было рассчитано на длительное использование.Инженеры создали устройство для выдачи кратковременного питания.

    Часто не работает прикуриватель из-за того, что к нему были подключены переносные компрессоры. Это приводит к нагреву проводки. К поломке также приводят несколько маломощных устройств, подключенных к одной розетке.

    Есть и механическая причина. Это рыхлые и раскидистые усики в гнезде. Они просто перестают держать вилку. В этом случае ремонт очень прост.

    Прикуриватель ВАЗ

    Владельцы этих автомобилей часто сталкиваются с подобной ситуацией.Чтобы не нарваться на эту беду, не стоит питать компрессоры от прикуривателя. Также не рекомендуется ставить в розетку устройства, не соответствующие стандарту разъема. Кроме того, если не работает прикуриватель на ВАЗе, то следует проверить, не вставлял ли кто в розетку какой-либо железный предмет. Не используйте с этой универсальной розеткой устройства, оснащенные металлическими кольцами. Они часто вылетают из своих мест. Это может привести к короткому замыканию.

    Ремонт прикуривателя ВАЗ

    В первую очередь, если не работает прикуриватель, проверьте блок предохранителей.

    Если вы нашли сгоревший, вы должны заменить его. Однако иногда даже после этой процедуры напряжение может не появиться. Что делать? Разобрать гнездо.

    Как проверить напряжение?

    Нужно полностью снять прикуриватель. Вставьте обычную лампочку в заднюю часть патрона и включите зажигание. Лампа горит? Можно приступать к разборке — причина в гнезде.

    Как разобрать прикуриватель на ВАЗ?

    Прежде чем открутить гайку сзади и приступить к полной разборке, запомните, а лучше сфотографируйте положение контактов.Это значительно облегчит возможные трудности при сборке.

    А теперь можно переходить к полной разборке устройства. Вам нужно будет открутить гайку, затем отогнуть металлические части от пластиковых. Далее – отсоединяем металлические детали. Вы обязательно увидите пластину из слюды. Это полупроводник. Его необходимо удалить.

    Тогда приступайте к сборке. Напильник поможет вам удалить лишний металл, мешающий надежно установить прикуриватель на свое место.

    Если из этого ничего не вышло, то можно попробовать проверить провода на целостность. Не поленитесь снова разобрать гнездо, возможно, вы где-то что-то упустили. Также не забывайте, что при замене элемента нужно снять «минус» аккумулятора.

    «Форд Фокус»

    Не только в автомобилях от ВАЗ, но и в таких иномарках как Форд можно наблюдать неработающий прикуриватель. Чаще всего в сети перегорает предохранитель. Он имеет маркировку F109 и окрашен в желтый цвет.Рассчитан на ток до 20 А.

    Прикуриватель Форд Фокус не работает чаще всего из-за короткого замыкания в розетке или из-за потребителей, рассчитанных на ток, значительно превышающий допустимый.

    Короткие замыкания случаются потому, что большинство водителей не знают и никогда не задумываются о том, что в мире не существует стандартов геометрических размеров гнезда. Производители зарядных устройств и всего, что вставляется в розетку, делают вилки разной длины и диаметра.

    Перед тем, как вставлять что-либо в розетку, убедитесь, что разъем подходит идеально. Чуть меньший диаметр — риск получить короткое замыкание.

    Как заменить предохранитель в автомобиле Ford?

    Если не работает прикуриватель Ford, и вы решили заменить предохранитель, то сядьте на пассажирское сиденье и снимите защитную полку. Он расположен под перчаточным ящиком. Поверните защелки и потяните блок вниз. В левом ряду вы увидите нужный вам предохранитель.

    Он второй снизу. Будет лучше, если ты найдешь чертеж своего Форда. Да, достать предохранитель вручную непросто, поэтому приготовьте круглогубцы.

    Как заменить прикуриватель?

    Для замены необходимо снять правую крышку туннеля. У подножия пассажирского сиденья нужно снять защелку и открутить винт. Затем снимите колпачок. Вы увидите дыру. Засуньте туда руку и отсоедините провода от розетки.Их всего три.

    Теперь осталось только вытащить стекло из посадочного места.

    Если не получилось вытащить стекло просто так, то есть вариант сломать пластик каким-нибудь инструментом, и при этом вынуть стекло по частям.

    «Тойота»

    В том случае, если прикуриватель Toyota не работает, нужно начать с проверки предохранителей. Автолюбители утверждают, что в инструкции к этой марке автомобиля о них ничего не указано.

    В большинстве моделей необходимый блок предохранителей находится под рулевой колонкой.

    На некоторых моделях — под бардачком. Предохранитель рассчитан на 15 А. Многие пытаются установить предохранители на 20 А и сталкиваются с тем, что система не работает.

    Также многие владельцы меняют стекло целиком. Стекло имеет алюминиевую вставку. Она часто выгорает.

    Если ничего не работает

    Бывает и так, что не работает прикуриватель и радио, в этом случае рекомендуется проверить монтажный блок.Внимательно проверьте все предохранители. Если ничего не найдете, то внимательно проверьте и реле. Часто виноват кислый контакт. После промывки или пайки монтажного блока все становится на свои места.

    Электрическая схема прикуривателя тоже достаточно проста. На самом деле он подключается напрямую к аккумулятору, а точнее через монтажный блок.


    Данная конструкция полностью обоснована, и в ней учтены особенности эксплуатации данного устройства.Все дело в том, что при включении прикуривателя через него протекает ток достаточно большой силы. Здесь пора провести аналогию со стартером.

    Если перестал работать прикуриватель, то причин этому может быть несколько:

    • предохранитель;
    • провода;
    • неисправность самого устройства.

    Рассмотрим их подробнее. Первым делом при неисправности прикуривателя необходимо проверить целостность предохранителя.В общем, при поиске причин лучше всего идти по пути от простого к сложному. Нужный нам в данном случае предохранитель находится в монтажном блоке. Узнать его можно по маркировке — соответствующее изображение F18. Кстати, на электрической схеме «десятки» обозначаются точно так же. Ток через этот предохранитель не должен превышать 25 ампер.

    Однако есть еще более простой способ. В этом случае даже не нужно вскрывать монтажный блок и осматривать предохранитель.Обычно достаточно попробовать включить зажигание и запустить вентилятор системы отопления. Это действительно самый простой способ проверить. Все дело в том, что вентилятор и прикуриватель «посажены» на один и тот же предохранитель — вышеупомянутый F18. Соответственно, при выходе из строя ни одно из этих устройств работать не будет.

    Проблема решается просто. Вскройте монтажный блок и замените неисправный предохранитель. Для того чтобы сделать эту операцию более удобной, конструкторы предусмотрели пинцет. Он находится внутри монтажного блока, и с его помощью действительно гораздо удобнее манипулировать таким тонким предметом, как предохранитель.Осталось только проверить работу прикуривателя, и, если все в порядке, закрыть монтажный блок.


    Однако предохранитель не всегда является причиной неисправности. Если он в полном порядке, то проблему следует искать в проводах, соединяющих монтажный блок и прикуриватель. Возможно, где-то был обрыв. Как исправить эту проблему, наверное, объяснять не нужно. Только не забудьте потом тщательно заизолировать восстановленный провод.

    Впрочем, причина может быть и более серьезной — речь идет о поломке самого прикуривателя. Однако прежде чем приступить к разборке устройства, осмотрите также предохранитель F6. Все дело в том, что когда он перегорает, это также может спровоцировать выход из строя прикуривателя. Если предохранитель в порядке, то другого выхода, кроме разборки прикуривателя, не будет.

    Ни для кого не секрет, что за последние годы функции прикуривателя в автомобиле сильно изменились.Если раньше он был вместо спичек или зажигалки, то теперь это незаменимый атрибут в жизни каждого автовладельца. С помощью прикуривателя, а точнее его розетки, можно подзарядить мобильный телефон, подключить множество автомобильных аксессуаров, напрямую зависящих от электричества. Поломка прикуривателя в автомобиле – достаточно распространенная и важная проблема для комфортной эксплуатации транспортного средства.

    Функции

    В современном обществе важна не столько зажигалка, сколько само ее гнездо.Именно в это отверстие вставляются другие электроприборы, без которых многие автолюбители просто не могут обойтись. Говоря простым языком, розетка — это так называемая розетка, но не в доме, а в машине. С его помощью можно заряжать мобильный телефон, подключать навигаторы и радары, пользоваться мобильной автомойкой. С каждым годом рынок пополняется все более новыми, разнообразными автомобильными аксессуарами и гаджетами, работающими на электричестве.

    Прикуриватель — простое устройство, но даже при его работе могут возникать казусы и неисправности.В данной статье описаны все возможные варианты неисправности прикуривателя, а также способы устранения неполадок для разных марок автомобилей.

    Принцип действия

    Внешне выглядит как металлический картридж, на котором находится пластиковая кнопка с изображением сигареты. Во время использования внутри патрона нагревается нихромовая спираль, от которой и происходит процесс зажигания. Плюс подается на «жало» вилки, входящей в приборную розетку. После нагрева спирали до определенной температуры срабатывает тепловое реле, и кнопка возвращается в исходное положение.Для защиты прикуривателя используется предохранитель на 10А. Все предохранители расположены в блоке, который может располагаться под приборной панелью, сиденьем и даже в багажнике. Расположение блока предохранителей зависит от марки автомобиля.

    Важно! Устройства с напряжением 12 вольт подключаются к гнезду прикуривателя. Именно поэтому не следует подключать их с более мощным напряжением — это грозит коротким замыканием в цепи освещения.

    Расположение прикуривателя может быть различным.В большинстве автомобилей он расположен под автомагнитолой. Для удобства использования есть возможность перенести расположение прикуривателя или установить дополнительную розетку. В новых марках автомобилей с завода предусмотрено несколько гнезд прикуривателя.


    Причины отказа

    • перегорел предохранитель;
    • сгоревший разъем прикуривателя;
    • обрыв проводки.

    Чаще всего люди сталкиваются с проблемой перегоревшего предохранителя.Этот казус встречается как на отечественных автомобилях, так и на иномарках. Виновниками чаще всего становятся автомобильные гаджеты. Работа прикуривателя рассчитана на определенную мощность, и очень часто автовладельцы подключают в отверстие устройства, превышающие допустимое значение, из-за чего перегорает предохранитель.

    Решение достаточно простое — следует заменить перегоревший предохранитель и продолжать использовать разъем только для слаботочных устройств. Мощные устройства следует подключать напрямую к аккумулятору.Хотя это неудобно, а иногда и не так просто, это намного безопаснее и эффективнее.

    Совет! Если вы часто пользуетесь мощными устройствами, а времени на подключение к аккумулятору нет, то можно вывести дополнительный разъем с розеткой питания, которая подключается непосредственно к нему.

    Еще одна причина, по которой не работает прикуриватель – короткое замыкание в разъеме устройства. Это происходит, когда в розетку вставлены болтающиеся или нестандартные вилки.Также не стоит ставить более мощные предохранители — это точно приведет к короткому замыканию. Если все-таки с вами приключилась такая беда, то единственно верным решением проблемы будет замена гнезда.

    Если причина поломки не в перегоревшем предохранителе или розетке, то стоит проверить на целостность проводку прикуривателя. Возможно тока нет из-за припаянного провода. Его следует припаять и проверить все разъемы — они должны быть плотно вставлены.

    Каждый второй водитель хотя бы раз в жизни задавался вопросом, почему перестал работать прикуриватель. Поэтому вопрос самостоятельного ремонта поломок очень актуален.

    Пошаговый ремонт своими руками

    Если вы решили разобраться почему не работает прикуриватель и устранить поломку вашего автомобиля, то ниже инструкция по ремонту.

    Для этого вам понадобится:

    • перчатки;
    • новый предохранитель;
    • паяльник;
    • набор отверток;
    • пинцет.

    Совет! Не всегда нужно ехать в автосервис. Если вы хоть немного разбираетесь в своем автомобиле, то с помощью подсказок разберетесь, почему в машине не работает та или иная деталь.

    Порядок действий:

    • В первую очередь нужно обесточить автомобиль во избежание короткого замыкания. Для этого снимите минусовую клемму с аккумулятора;
    • Часто прикуриватель находится на центральной консоли. Отодвиньте сиденье водителя, чтобы подобраться к неработающему устройству;
    • с помощью фонарика необходимо осмотреть гнездо устройства на наличие посторонних предметов.Если таковые имеются, то с помощью пинцета извлеките их из гнезда;
    • если устройство не работает, то первым делом нужно проверить предохранитель. Из-за его перегорания ток перестает поступать на устройство. Руководство пользователя поможет вам найти его. При необходимости замените его и еще раз проверьте, работает ли устройство;
    • если проблема не устранена, то снимите прикуриватель пассатижами. Обычно он сидит крепко, поэтому нужно приложить небольшое усилие, но делать все аккуратно и не резко, чтобы не повредить безель и провода;
    • Обратите внимание на внешний вид устройства.На нем не должно быть темного нагара. Проверьте провода на целостность, все разъемы должны плотно прилегать;
    • если найдете припаянные провода, то припаивайте их паяльником и не забывайте о хорошей изоляции;
    • затем соберите устройство и проверьте его работоспособность.

    Другие проблемы на работе

    К сожалению, существует ряд причин, по которым не работает прикуриватель в машине. Все они разные и у каждой марки автомобиля могут быть свои.

    Многие владельцы Dodge Caliber также сталкиваются с проблемой неработающего прикуривателя. Чаще всего устройство ломается во время работы в нем другого устройства, и из панели начинает идти дым. Происходит это из-за перенапряжения, которое дают более мощные устройства, подключенные к разъему. В данной модели такая поломка может привести к проблемам в работе других устройств, так как перегоревший провод находится в общем жгуте других. Справиться с решением этой поломки самостоятельно не получится, ведь придется снимать всю переднюю консоль.Такая поломка может повториться, поэтому лучше всего будет установить предохранитель в сам прикуриватель.

    На отечественных марках автомобилей также часто случаются казусы в работе прикуривателя. Конечно, чаще всего предохранители перегорают из-за неправильного использования разъема прибора. Проверить, почему не работает прикуриватель на ВАЗ 2110, достаточно просто. Включите вентилятор печки — если он не работает, то причина в предохранителе F18. Дело в том, что эти два устройства работают от одного и того же предохранителя и его перегорание приводит к выходу из строя сразу двух устройств.Для его замены не нужно лезть под капот, он находится слева от руля в блоке предохранителей. Однако если вентилятор работает, то не стоит сразу грешить на проводку. Нужно проверить предохранитель, который обозначен как F6. Мало кто знает, но это тоже влияет на работу устройства и возможно причина в его перегорании.

    Результаты

    Конечно, роль прикуривателя стала играть важную роль в жизни многих автомобилистов.Бывает, перепробовав все возможные варианты поломок устройства, выясняется, что причина кроется в разболтанных усах, находящихся в гнезде. Из-за этого прикуриватель не фиксируется и перестает работать. После длительного и частого использования усики «обламываются» и ток не поступает на все устройства, которые вставлены в отверстие. Вы можете решить эту проблему самостоятельно. Достаточно немного отогнуть усики и затем проверить работу прикуривателя или другого устройства.

    Однозначно использовать все устройства автомобиля строго по прямому назначению, но когда автопроизводитель не учел всех потребностей использования дополнительных гаджетов, то без гнезда прикуривателя никуда. При эксплуатации для других устройств достаточно помнить, что нельзя подключать более мощные устройства, вставлять болтающиеся вилки и другие неподходящие предметы. В этом случае вас не зацепит проблема перегоревших предохранителей и неработающего прикуривателя, в самый неподходящий момент.

    Раньше прикуриватель использовался в автомобилях для прикуривания сигарет. Теперь это своеобразная розетка на 12 В, в которую можно подключать различные устройства. Поэтому, если 2107 не работает, это иногда большая проблема. Что это за устройство, какие основные неисправности, как заменить и отремонтировать прикуриватель, раскрыто в этой статье.

    [ Скрыть ]

    Устройство и назначение прикуривателя

    Изначально автомобильный прикуриватель (АП) был задуман для того, чтобы водитель мог прикурить сигарету, как от уголька от костра.Устройство устройства не менялось с момента его появления, хотя и присутствует в салонах даже первых отечественных автомобилей.

    Прикуриватель ВАЗ 2106 представляет собой устройство, состоящее из двух частей: гнезда и патрона. Металлический патрон имеет пластиковую ручку в виде кнопки. В центре раструба установлен металлический стержень, играющий роль положительного полюса.

    Роль минуса выполняет металлический корпус картриджа. Между корпусом и металлическим стержнем находится изолятор, исключающий контакт между плюсом и минусом.Соединение плюсовых и минусовых контактов происходит через нихромовую спираль, выполняющую роль нагревательного элемента.

    При подаче тока на нагревательный элемент он начинает нагреваться до высокой температуры. Когда катушка нагревается до необходимой температуры, ток перестает течь, благодаря тепловому реле. Розетка для устройства расположена на приборной панели, в зоне комфортного доступа водителя. Он выполнен в виде продолговатого углубления с металлической оболочкой, играющей роль минуса.

    Внутри находится центральный контакт, на который подается плюс от аккумулятора. Корпус АП оснащен подсветкой, которая автоматически включается вместе с внешним освещением.

    Для включения режима нагрева ручку нажимают так, чтобы картридж погрузился в гнездо и зафиксировался в нажатом состоянии. Его удерживают биметаллические пластины. В этот момент плюсовой контакт картриджа соединяется с плюсом розетки, а минусовой контакт розетки с минусовой клеммой картриджа.Ток, протекающий по спирали, нагревает ее. Нагревательный элемент достигает нужной температуры в течение 15-20 секунд.

    Затем под воздействием высокой температуры биметаллические пластины начинают расходиться, раздается характерный щелчок, и картридж принимает прежнее положение за счет внутренней пружины.

    При низком напряжении в бортовой сети картридж будет дольше оставаться в розетке, так как время нагрева увеличится.

    Со временем к прямому назначению прикуривателя добавилась дополнительная функция — его стали использовать как розетку для подключения различных электронных устройств.К розетке AP подключаются электроприборы, для питания которых достаточно 12 В бортовой сети.

    Производители электрооборудования выпускают большое количество устройств, которые можно использовать в автомобиле:

    • вентилятор;
    • обогреватель;
    • пылесос;
    • зарядное устройство для телефонов и других устройств;
    • устройства для внутреннего освещения и т.п.

    Все дополнительные электроприборы оснащены специальным входом для подключения к ТД.Появились специальные разветвители, позволяющие подключать к розетке сразу несколько устройств.

    Точка доступа получает питание от бортовой сети автомобиля. Прикуриватель ВАЗ 2107, как и у других отечественных автомобилей, подключается через монтажный блок напрямую от аккумулятора без использования реле. защищен специальным предохранителем на 10 А, который находится в монтажном блоке. При большом токе плавится нить в предохранителе и размыкает электрическую сеть, предотвращая воспламенение.


    Схема подключения прикуривателя

    К гнезду АП подключаются три провода:

    • «минус» — масса;
    • «плюс» — соединен через предохранитель с аккумулятором;
    • «плюс» — подключается к подсветке устройства от габаритных огней, работает только при включенном внешнем освещении.

    Во избежание ситуации, когда картридж может заклинить в гнезде, АП оснащен специальным предохранительным устройством, предохраняющим его от перегрева и возгорания.Простейшее такое устройство выполнено в виде плавкой металлической шайбы. При слишком высокой температуре он плавится и замыкает накоротко питание ТД, а предохранитель в монтажном блоке перегорает, обесточив осветительный прибор.

    Некоторые прикуриватели имеют встроенный предохранитель, который находится в самой розетке. Если шайба расплавилась или сгорела, ее необходимо заменить. В последнее время в качестве предохранителя стали устанавливать многоразовый термобиметаллический взрыватель. При перегреве он шунтирует силовые контакты, не давая перегореть предохранителю, но через некоторое время биметаллический предохранитель остывает и снова размыкает контакты.

    Возможные неисправности: признаки и причины

    АП не относится к надежным соединительным устройствам, которые служат долго. Это не предусмотрено его конструкцией. Хорошей фиксации можно добиться, увеличив количество прижимных лапок, но универсального приспособления пока не придумали. Фактически у АП есть только центральный подпружиненный контакт и две прижимные лапки. Центральный контакт может располагаться глубоко, а может быть близко.

    Пазы для ножек на вилке могут не совпадать с расположением самих ножек.В процессе эксплуатации ухудшается контакт между вилкой и розеткой устройства, в месте соединения появляется искрение, в результате возможно короткое замыкание.

    Возможные неисправности ТД:

    1. Плохо закрепленный штекер в розетке. В такой ситуации водителю приходится держать голову в розетке до полного ее прогрева, что неудобно и небезопасно при управлении автомобилем. Причина неисправности — усики в гнезде. Со временем они изнашиваются и перестают удерживать картридж.Для устранения этой поломки нужно просто согнуть усики (автор видео И не только о рыбалке).
    2. Прогар спирали в картридже. В этом случае решить проблему можно заменой головки прикуривателя. Восстановить работоспособность старой спирали можно, очистив ее от нагара и нагара. По правилам катушка нагревается до красна за 20 секунд после включения. Тогда голова должна выскочить. Когда это рано или поздно произойдет, можно регулировать время нагрева, подгибая или разгибая контакты устройства.Если предпринятые меры не помогают, головку необходимо заменить.
    3. Перегорел предохранитель. Обычно в ситуации перегорания предохранителя виноват водитель, когда через разветвитель подключено несколько дополнительных устройств. Таким образом, увеличивается нагрузка на прикуриватель, который рассчитан на определенную мощность. Кроме того, предусмотрено кратковременное использование гнезда. Поэтому при превышении нагрузки и непрерывном использовании предохранитель перегорает. Проблема решается заменой детали, которая находится в предохранительном блоке.Предохранитель рассчитан на 10 А. Не стоит устанавливать деталь с большим номиналом, так как это грозит перегоранием гнезда АП.
    4. Обрыв проводки. Работа устройства может быть нарушена при обрыве проводки. Провода могут пережиматься или перетираться в процессе эксплуатации, что приводит к пропаданию контакта. Обнаружить разрыв можно с помощью мультиметра, прозвонив цепь. Найдя место обрыва, нужно заменить оторванный кусок на целый. Провода должны быть надлежащим образом изолированы, чтобы избежать возгорания.

    Инструкция по ремонту и замене механизма

    Ремонт и замена прикуривателя ВАЗ 2107 аналогичны «ВАЗ классика», поэтому их можно рассматривать как пример.

    Для выполнения данных процедур необходимо подготовить следующие инструменты:

    • набор отверток;
    • плоскогубцы;
    • небольшие щипцы или пинцеты;
    • паяльник с припоем;
    • переносная лампа или фонарик;
    • изолента;
    • хлопчатобумажные перчатки.

    Ремонт состоит из последовательности действий:

    1. Автомобиль обесточивается путем снятия минусовой клеммы с аккумулятора.
    2. В салоне находим, где находится розетка АП и обеспечиваем к ней удобный доступ. Обычно он находится на центральной консоли, поэтому водительское кресло отодвигаем максимально назад.
    3. Теперь достаем картридж из гнезда. Осветив внутреннюю часть гнезда, нужно удалить с помощью пинцета все посторонние предметы или осколки.
    4. Далее проверьте предохранитель, расположенный в монтажном блоке. Обычно он находится под капотом, приборной панелью или сиденьем водителя. Вскрыв предохранительный блок, находим нужный предохранитель. Его расположение можно определить по схеме на внутренней стороне крышки или в инструкции по эксплуатации. Вынимаем нужный предохранитель и проверяем его перемычку. Если он сгорел, деталь подлежит замене.
    5. Если замена предохранителя не помогает, переходите к следующему шагу. Выньте прикуриватель.Затем пассатижами аккуратно берем обод и, не прилагая усилий, тянем его на себя, чтобы не повредить проводку.
    6. На вытащенном элементе осматриваем место, где он припаян к АП. При обнаружении некачественного соединения или обрыва необходимо подпаять провод. При осмотре обратите внимание на провода и изоляцию. Если есть потертости, провод следует заизолировать.
    7. После проверки устройства на работоспособность возвращаем безель на прежнее место.

    Фотогалерея «Замена АП»

    Для замены АП необходимо знать, как подключить прикуриватель. Информацию можно найти в руководстве пользователя.

    Чтобы заменить розетку, выполните следующие действия:

    1. Отсоедините отрицательную клемму аккумуляторной батареи.
    2. Вынимаем патрон из гнезда.
    3. С помощью тонкой отвертки отогните фиксаторы.
    4. Аккуратно поддев внутреннюю часть разъема, отсоедините разъем.
    5. Меняем панельку и устанавливаем все в обратном порядке.

    При замене лампочки прикуривателя выньте зажим из патрона. Замените лампочку и вставьте обратно зажим.

    Вывод

    Идеальным вариантом использования зажигалки является ее прямое назначение — прикуривать сигареты. При использовании устройств нужно суммировать их мощность и следить, чтобы общая нагрузка не превышала разрешенную. При эксплуатации АП следует помнить, что даже при выключенном зажигании устройства, подключенные к его розетке, будут потреблять электроэнергию.Это может привести к полной разрядке батареи. Не вставляйте незакрепленные вилки или некачественную сборку в гнездо точки доступа, это может привести к короткому замыканию.

    Если, необходимо выявить причину и устранить ее. Пока проблема не будет устранена, лучше не использовать устройство во избежание возгорания или короткого замыкания. Если проблема не может быть устранена, лучше заменить устройство.

    ВАЗ 2110, то лампа А12-4 используется специально для подсветки прикуривателя.Замена лампы прикуривателя, как и самого прикуривателя, осуществляется следующим образом:

    Процедура замены подсветки в прикуривателе.

    1. Просто отсоедините провод прямо от клеммы — это специальное устройство для подключения к аккумулятору.
    2. Затем нужно снять облицовку с туннеля, расположенного на полу.
    3. После этого сожмите экран лампы так, чтобы выступы экрана свободно проходили через прорези в световоде прикуривателя.
    4. Затем, немного приоткрыв экран, нужно извлечь из него патрон с лампой.
    5. Затем просто нажмите на лампу, повернув ее на 90°, и извлеките из патрона.
    6. Новую лампу необходимо установить в том же порядке, только в обратном порядке. Особое внимание следует обратить на то, что при установке патрона с лампой непосредственно в экран в этом случае кольцевой выступ, расположенный на патроне, обязательно должен входить в указанные пазы экрана.

    Порядок замены прикуривателя, если не работает прикуриватель ВАЗ 2110

    1. Просто отсоедините провод от клеммы — это устройство, специально предназначенное для подключения аккумулятора. Затем нужно снять вагонку с пола.
    2. Снимите картридж.
    3. После этого продеть колодки вместе с проводами прикуривателя, а также подсветки через отверстие в облицовке пола, расположенное в туннеле.
    4. Затем сожмите экран лампы так, чтобы выступы экрана вышли из прорезей в световоде прикуривателя, затем снимите его.
    5. Нажмите отверткой непосредственно на защелку гнезда прикуривателя, чтобы оно отсоединилось от световода.
    6. Вытолкните втулку из подкладки.
    7. Выньте гнездо прикуривателя прямо из обшивки, пропустив колодку с проводами через отверстие.
    8. Спираль должна нагреваться в течение двадцати секунд.Затем патрон прикуривателя одновременно со щелчком должен вернуться в исходное положение. В том случае, если патрон возвращается в исходное положение намного раньше, либо позже, чем через двадцать секунд, то нужно отрегулировать прикуриватель. Специально для этого подогните или разогните соответствующие контакты, которые указаны стрелками.
    9. Далее нужно отжать пластиковые защелки от световода и, выдвинув световод, просто снять его с облицовки.
    10. Установите прикуриватель в обратном порядке. При установке световода выступ на нем обязательно должен вдавливаться в прорезь на накладке.

    Горит лампа уровня ВАЗ 2114. Горит лампочка неисправности двигателя: причины и последствия

    Многие автомобилисты сталкивались с тем, что на панели приборов ВАЗ-2114 загорается индикатор низкого уровня масла в двигателе. Это может быть связано с несколькими причинами. Но, главная из них — низкий уровень масла.Хотя, неисправность может быть скрыта и в другом месте. Рассмотрим причины загорания лампочки уровня масла, а также методы решения проблемы.

    Расположение и расположение датчика уровня масла

    Индикатор низкого уровня масла в двигателе на панели приборов (отмечен красной стрелкой)

    Лампа низкого давления масла в двигателе на панели приборов (отмечена красной стрелкой), не путать с маслом низкого давления

    Итак, становится понятно, что загорание лампочки уровня масла неразрывно связано напрямую с датчиком.Прежде чем определить неисправность, нужно разобраться с расположением датчика под капотом.

    Датчик уровня масла находится возле блока, внизу.

    Датчик имеет трубку, которая доходит почти до дна картера. Контактная группа подает сигнал на соответствующие индикаторы. ВАЗ-2114 до 2004 года электрические соединения шли прямо на приборную панель, как и у «девятки». Но, после модернизации автомобиля, с 2004 года, контактные соединения электрической цепи были проложены через электронный блок управления, который должен контролировать работу датчиков и двигателя в целом.

    Причины неисправности

    Датчик уровня масла

    Когда стало понятно устройство работы и схема датчика уровня масла, можно рассматривать причины загорания лампочки на приборной панели. Итак, давайте рассмотрим все возможные причины, из-за которых может загореться индикатор на приборной панели ВАЗ-2114:

    • Низкий уровень масла.
    • Сбой датчика.
    • Проблема в цепочке контактов.
    • Короткое замыкание внутри панели приборов.
    • Неисправности в ЭБУ.

    Методы исключения

    Теперь можно перейти непосредственно к методам устранения. Для начала нужно разобраться, какие инструменты могут понадобиться для выполнения процесса: ключ на 10, мультиметр, набор отверток. Теперь, когда все собрано, можно переходить непосредственно к решению задач.

    Низкий уровень масла на щупе

    Выработка и износ масла могут влиять на его уровень, поэтому стоит регулярно проверять этот показатель.

    Также причиной потери масла в двигателе может быть или поломка в картере . Для устранения потери масла стоило устранить неисправности, вызвавшие появление эффекта, а затем долить масло до необходимого уровня.

    Для измерения указателя уровня масла имеется специальный инструмент, который называется — масляный щуп. Он расположен в передней части двигателя. . Когда показатель опускается ниже отметки MIN, на приборной панели загорается индикатор уровня масла.

    Отказ датчика

    Неисправность датчика также может стать причиной появления индикатора уровня масла на приборной панели. Для устранения неисправности необходимо проверить датчик, и если он неисправен, заменить деталь.

    старый и новый датчик уровня масла

    Процесс замены достаточно прост и не сложен. Рассмотрим вопрос подробнее. Для выполнения операции нужен ключ на 10. Итак, приступим непосредственно к последовательности действий, направленных на замену датчика:

    1. Автомобиль должен быть установлен так, чтобы был доступ снизу.Для этого подойдет смотровая яма, подъемник или эстакада.
    2. Отсоедините отрицательную клемму аккумулятора.

      Снимите отрицательную клемму с аккумулятора

    3. Если есть, то необходимо демонтировать нижнюю защиту двигателя.

      Снятие картера двигателя

    4. Демонтируем поддон. Предварительно требуется.

      Выполняем демонтаж поддона

    5. Отсоедините жгут проводов от датчика.
    6. Ключом или головкой на 10 откручиваем датчик уровня масла.

      Снимаем датчик

    7. Устанавливаем новый датчик и проводим необходимую сборку.
    Проблема в цепи контакта

    Диагностика микросхем датчика уровня топлива

    Неоднократно причиной может быть обрыв провода или контактной группы, идущей от датчика к электронному блоку управления. Опираясь на схему электропроводки автомобиля, находим соответствующий провод, который питает счетчик.Далее находим точно такой же в ЭБУ и прозваниваем.

    Если контакта нет, то в этом месте произошел обрыв и его следует устранить. Такую же процедуру проводим с остальными проводами.

    Короткое замыкание внутри панели приборов

    Неоднократно причиной загорания лампочки на приборной панели может быть короткое замыкание внутри платы приборной панели. Это может быть вызвано коррозионным повреждением или коротким замыканием внутри приборной панели. Таким образом, решением проблемы может стать ремонт платы или замена комбинации приборов.

    Проверка контактов платы приборной панели

    Определить неисправность довольно просто: достаточно разобрать приборку и посмотреть на контактные соединения. Также для полной уверенности можно прозвонить контакты на плате и непосредственно на самой контрольной лампе, с помощью тестера.

    Неисправности в ЭБУ ВАЗ-2114

    Последним возможным вариантом, где стоит искать неисправность, становится электронный блок управления. Здесь могут возникать ошибки, которые послужат не только загоранию лампочки уровня масла, но и неисправности других индикаторов, таких как спидометр, указатель поворота и другие.

    Метод устранения неисправности заключается в подключении ноутбука или планшета к «мозгам» автомобиля через OBD-кабель и стандартном тесте. Если в ЭБУ обнаружены ошибки, связанные с уровнем масла, их необходимо сбросить. Процедуру сброса всех ошибок нужно проделать для всех накопившихся в «мозгах» индикаторов. После этого проблема должна исчезнуть, если нет, то неисправность нужно искать в другом месте.

    выводы

    Определить причину лампочки уровня масла в двигателе на приборной панели ВАЗ-2114 достаточно просто даже для начинающего автомобилиста.Диагностические операции проводятся просто и понятно. Единственной проблемой может стать сброс ошибок ЭБУ, который рекомендуется доверить профессионалам.

    Приборные панели классических автомобилей отечественного производства малоинформативны. На них нет ничего лишнего, кроме показателей работы основных систем двигателя, но их вполне достаточно, чтобы водитель вовремя был проинформирован о возможных неисправностях автомобиля. Однако бывает, что какое-то устройство выходит из строя, и тогда определить поломку на начальной ее стадии становится невозможно.

    В этой статье мы поговорим о случае, когда постоянно горит лампочка заряда аккумулятора, на примере популярных классических автомобилей и ВАЗ 2107. Мы рассмотрим основные причины этого явления, а также постараемся диагностировать и устранить возможные неисправности.

    Зачем нужен световой индикатор заряда аккумулятора

    Для того, чтобы водитель мог следить за состоянием заряда аккумулятора, на панели приборов размещен вольтметр со шкалой, а также небольшое красное окошко, под которым сигнальный свет.Когда вставляем ключ зажигания и поворачиваем его в замке на один оборот, эта лампа включается и горит красным цветом. Стрелка вольтметра находится в нулевом положении. Это означает, что генератор находится в состоянии покоя и не заряжает аккумулятор. При запуске двигателя лампа должна погаснуть, а стрелка прибора отклониться вправо, показывая величину подаваемого на аккумулятор напряжения. Это происходит, когда система электропитания машины полностью исправна. Но если лампочка зарядки аккумулятора ВАЗ 2107 или 2106 горит и после запуска двигателя, скорее всего, где-то произошел сбой.И наша задача найти его причину и устранить.

    О чем может свидетельствовать постоянно горящая лампочка заряда аккумулятора?

    Если в ВАЗ 2107 или ВАЗ 2106 причина может быть только одна — на аккумулятор не поступает напряжение от генератора, либо поступает, но его значение недостаточно. Неисправностей, которые к этому приводят, может быть несколько:

    • нарушение нормального контакта на клеммах аккумулятора;
    • ослабление или повреждение ремня генератора;
    • отсутствие контакта его «минусового» вывода с «массой»;
    • обрыв цепи возбуждения ротора или износ щеток генератора;
    • неисправен диодный мост.
    • неисправность соответствующего предохранителя;
    • Поломка реле-регулятора.

    Перед началом диагностики

    Важным моментом в решении вопроса с зарядкой аккумулятора ВАЗ 2107 или 2106 является сам факт получения напряжения от генератора. Иными словами, если он вообще не входит в батарею, удивляться нечему. В такой ситуации лампа должна гореть. А вот если лампочка зарядки аккумулятора горит, а зарядка есть, решить эту проблему будет немного сложнее.

    Нашей первоочередной задачей является определение того, подается ли напряжение на батарею. Сделать это совсем не сложно, тем более, что для этого понадобится всего один прибор — вольтметр или включенный в его режим мультиметр. Заводим двигатель автомобиля, поднимаем капот и измеряем напряжение на клеммах аккумулятора при работающем генераторе. Если все элементы системы исправны, вольтметр должен выдавать 13,6-14,2 В, и не меньше. Это рабочий индикатор для нормальной зарядки аккумулятора.Если напряжение ниже этих значений, то есть какая-то неисправность.

    Обрыв контакта на клеммах аккумулятора

    На данном этапе диагностики необходимо проверить состояние клемм проводов и клемм аккумулятора. Часто они окисляются, в результате чего контакт между ними ослабевает. В случае, когда лампочка аккумулятора горит, а зарядка идет, чаще всего причина именно в этой неисправности.

    Генератор работает нормально, напряжение на клеммы подается, но пропадает из-за плохого контакта.Вот и получается, что зарядка идет, но лампочка зарядки аккумулятора горит. Причем горит он в большинстве случаев тусклым светом. Такая неисправность устраняется зачисткой клемм и контактных выводов аккумулятора, а также обработкой их водоотталкивающей жидкостью.

    Ослабление или повреждение ремня генератора

    При диагностике обязательно проверять состояние. Иногда случается так, что из-за его длительной эксплуатации или под воздействием других факторов он деформируется, в результате чего привод генератора дает люфты.Обратите внимание и на натяжение ремня. К такому же эффекту приводит его ослабление.

    Если ремень не деформирован и не имеет видимых повреждений, его можно просто подтянуть. В противном случае его необходимо заменить. Натяжение ремня считается нормальным, при котором его можно провернуть вокруг горизонтальной оси на 85-90 градусов.

    Отсутствие контакта выхода генератора с «массой»

    Эта неисправность, как и первая в нашем списке, возникает из-за окисления выводов и клемм.Кроме того, возможно нарушение контакта из-за ослабления их крепления. Решением этой проблемы является очистка клемм и выводов, а также обработка их жидкостью типа ВД-40.

    Неисправности генератора

    В случае, когда лампочка зарядки аккумулятора горит, но зарядка есть (ВАЗ 2106, 2107), генератор подлежит обязательной проверке. Самые распространенные его проблемы в контексте нашей неисправности — это обрыв в цепи возбуждения ротора или износ (повреждение) щеток.

    В первую очередь необходимо разобрать и разобрать генератор. Для проверки обмотки ротора используем тот же мультиметр, включенный в режим омметра. Подсоединяем его щупы к выводам обмотки и измеряем ее сопротивление. Для рабочего ротора оно не должно быть меньше 4,5 Ом. Если сопротивление не достигает этого значения, скорее всего, где-то произошло межвитковое замыкание. В случае, когда он вообще не определяется, возможен обрыв обмотки.

    Перейдем к кистям.Вынимаем их из посадочных мест и осматриваем на предмет износа. Если длина щеток не превышает 7 миллиметров или на них есть признаки повреждения, меняем их. Обратите внимание также на состояние щеточного коллектора. При обнаружении дефектов в его медных пластинах меняем ротор.

    Диодный мост

    Диодный мост используется для преобразования переменного напряжения в постоянное. В случае пробоя хотя бы одного из диодов прибор перестает справляться со своими задачами, из-за чего в бортовую цепь машины начинает поступать не соответствующее его параметрам напряжение.Именно поэтому выпрямительный мост необходимо проверять, когда лампочка зарядки аккумулятора горит, а зарядка есть (ВАЗ 2107, 2106).

    Также можно определить исправность диодов с помощью мультиметра в соответствующем режиме. Включаем тестер и подключаем красный щуп к плюсовой клемме моста, а черный щуп к одному из контактов с пометкой «АС». Пороговое (прямое) напряжение для кремниевых диодов находится в пределах от 400 до 1000 мВ. Если прибор показывает вам значение, не укладывающееся в указанные пределы, мост необходимо заменить.Отремонтировать его невозможно.

    Неисправность предохранителя

    Цепь зарядки аккумулятора, как и любая другая, защищена предохранителем. Находится в монтажном блоке под капотом автомобиля. В «шестерках» и «семерках» этот предохранитель обычно обозначается как F10, но, в любом случае, перед проверкой лучше просмотреть руководство пользователя. Чаще всего при его неисправности аккумулятор вообще не получает напряжения, но бывает и так, что именно он становится причиной того, что лампочка зарядки аккумулятора горит, а зарядка есть.

    Предохранитель проверяется тестером после его извлечения из гнезда. Если прибор показывает, что деталь пришла в негодность, просто замените ее.

    Неисправность реле-регулятора

    Еще одной причиной того, что лампочка зарядки аккумулятора горит, а зарядка есть, может быть выход из строя реле-регулятора. Он, собственно, и отвечает за своевременное включение и выключение этой лампы. На автомобилях ВАЗ 2106, 2107 реле установлено в моторном отсеке на верхней части брызговика колеса с правой стороны.Принцип его работы следующий. При включенном зажигании (при выключенном двигателе) ток от аккумулятора протекает через его замкнутые контакты и питает контрольную лампу.

    Когда запускаем двигатель, включается генератор, подавая на реле уже выпрямленное напряжение. Под действием него якорь устройства притягивается к сердечнику, размыкая контакты. После этого лампа должна погаснуть.

    Проверить реле самостоятельно несложно. Для этого достаточно отсоединить от него оба провода и замкнуть их между собой.Запускаем двигатель и смотрим на сигнальную лампу. Если не горит, меняем реле.

    Во избежание проблем, вызванных неисправностью электрической цепи зарядки аккумулятора, воспользуйтесь следующими советами.

    1. Уделите больше внимания приборной панели автомобиля. Так вы будете знать не только о состоянии зарядки аккумулятора, но и о работе других систем и механизмов.
    2. Систематически проверяйте ремень генератора. От ее состояния и напряжения зависит правильная работа всей бортовой сети при работающем двигателе.Обнаружив малейший дефект ремня, не откладывайте его замену.
    3. Не ленитесь хотя бы раз в месяц проверять напряжение, подаваемое генератором на клеммы аккумулятора. В случае несоответствия рекомендуемым показателям провести полную диагностику бортовой сети.
    4. Периодически проводите визуальный осмотр состояния клемм аккумуляторной батареи и проводов генератора. Обнаружив их окисление, зачистите их мелкой шкуркой и обработайте жидкостью типа ВД-40.
    5. Не допускайте попадания воды в генератор, аккумулятор и реле-регулятор. Это может вызвать короткое замыкание в электрической цепи. лучше доверить специалистам.
    6. При ремонте цепи зарядки аккумулятора избегайте использования деталей сомнительного качества.

    Лампочка аккумулятора ВАЗ 2110 систематически горит на приборной панели, не переживайте, прочтите наши рекомендации и у вас получится быстро устранить поломку. Эта проблема хорошо известна не только владельцам ВАЗов, но и иномарок, просто у последних она встречается гораздо реже.Многие неопытные водители сначала теряются при виде того, как горит индикатор, и начинают паниковать.

    Вот только все просто, так как эта поломка не опасна. Мы привыкли, что после запуска двигателя должно гаснуть все табло. Итак, где искать источник возгорания и как это сделать самостоятельно, рассмотрим подробнее в этой статье.

    Причины

    Горит лампочка аккумулятора ВАЗ 2110, на это есть две причины.Изготовителем предусмотрено, что контрольный индикатор должен загораться в момент запуска двигателя и гаснуть после. Если этого не наблюдается, то ваша аккумуляторная батарея просто не получает заряд от генератора.

    Второй вариант: лампа вообще не горит. .

    Возбуждение генератора

    Электрическая схема выглядит так: ротор генератора изначально намагничен, но ему не хватает тока для возбуждения, который может обеспечить батарея.После набора оборотов в обмотке генератора появляется ток, который через контакты поступает на диодный мост. Собственно последний одновременно питает аккумулятор и реле РС — 702. Вот это реле и есть индикатор, который мы видим на старте. Контакты замыкаются — диод горит, и наоборот.

    Где искать причину?

    Вот собственно на этом тема почему горит лампочка аккумулятора ВАЗ 2110 закончена. Рассмотрены все распространенные причины, а также способы их устранения.Надеемся, что наша рекомендательная статья поможет многим водителям быстро найти и устранить проблемы, продлив тем самым срок службы. транспортное средство. Пусть проблемы как можно меньше беспокоят вашу машину. Удачи тебе.

    Поломка автомобиля раздражает. Поломка станет неожиданной, если за автомобилем не следить и не прислушиваться к предупреждениям. Один из них — лампочка Check Engine». Как понять, в чем проблема, на что она указывает и что делать, если загорелась.

    Назначение кнопок

    Приборная панель в автомобиле — способ управления водителем уровень бензина, масла, работа двигателя или других компонентов автомобиля, гарантирующих комфортную и спокойную езду по бездорожью.

    Современные автомобили оснащены индикатором, необходимым для удобства и комфорта водителя. Если раньше неисправность двигателя приходилось находить только визуально или внимательно прислушиваясь к работе, то сегодня работает специальная лампочка. Он создан для удобства контроля состояния двигателя. В идеале он должен загораться только при запуске двигателя и гаснуть через пару секунд.

    Если лампочка не гаснет или загорается во время движения, то следует задуматься о неполадках в работе основного узла автомобиля.

    Насколько серьезными могут быть причины?

    Каждый сигнал на панели автомобиля является показателем того, что водитель должен быть внимателен. Когда загорается лампочка Check Engine, причин может быть несколько.

    1. Частой причиной является бензин. Из-за присадок, которые недобросовестные производители используют в бензине, двигатель работает неправильно, засоряется. Стоит сменить топливо или заправиться на другой заправке, и все работает корректно.
    2. Неисправные свечи.
    3. Сломанная катушка зажигания.
    4. Сработавший кислородный датчик (лямбда-зонд).
    5. Сломанный каталитический нейтрализатор выхлопных газов.
    6. Неправильная эксплуатация высоковольтных проводников.
    7. Неисправность форсунки.
    8. Топливный насос или топливный фильтр.

    Начать проверку стоит с горловины топливного бака. Если он не затянут до конца или на нем появляются дефекты, то лампочка свидетельствует о неправильной работе двигателя.

    Каждая из причин не очень страшна, но требует немедленного устранения.Если вовремя не обратить внимание и не диагностировать неисправность, можно привести к полной поломке двигателя и выходу машины из строя.

    Двигатель серьезный, но работа не обязательно требует капитального ремонта или замены двигателя. Работа мастеров важна в любом вопросе диагностики и ремонта двигателя. Но, если причина в свечах, то замена осуществляется самостоятельно и быстро, без привлечения мастеров.

    Что делать, если лампочка горит

    Если вы видите, что лампочка Check Engine не загорается, как должна (не гаснет после запуска двигателя или загорается во время движения), то вам следует остановиться для диагностики неисправности машина. Сделать это можно не сразу, но необходимо. Помните, если она загорается, это повод либо ехать на СТО на диагностику, либо проверять двигатель на наличие неисправностей.

    Первое, что можно сделать при загорании лампочки, это остановиться и послушать, как работает двигатель: не троит ли, нет ли посторонних шумов или стуков.Если вы слышите посторонние звуки, то они указывают на причину поломки опытному водителю. Если причина поломки вам не ясна, прямая дорога – на ближайшее СТО.

    Если горит лампочка некачественного топлива (это можно определить после диагностики, после исключения других причин), то мастера сервиса подскажут, что стоит поменять тип заливаемого в машину топлива или место, где вы привыкли к заправке.

    Также проводят визуальный осмотр двигателя на наличие трещин, неровностей, течей.Если вы сами обнаружили поломку, то по причине также проводится ремонт.

    • Датчик кислорода. Заменить его стоит самостоятельно, следуя инструкции по эксплуатации автомобиля той или иной марки. Если вовремя не произвести замену, то будет перерасход топлива и может сломаться катализатор, замена которого обойдется намного дороже.
    • Негерметичный топливный бак — причина попадания воздуха внутрь, а значит перерасход.Стоит либо заменить крышку, либо добиться герметичности прокладками.
    • Свечи. Это основной элемент, гарантирующий загар. топливная смесь. Если они работают неправильно, то машина вообще откажется работать. Замена свечей не составит труда, если вы уже опытный водитель. Менять можно либо только уже отработавшую свою свечу, либо все сразу, чтобы наверняка избежать неполадок в работе автомобиля. В магазине стоит купить комплект свечей специально для вашего автомобиля.Если вы не уверены, что купите нужный вариант и сможете его поменять, то отправляйтесь на СТО, где нужные детали уже есть и специалисты смогут произвести замену быстро и недорого. В вопросе свечей стоит помнить, что машины старого образца требуют замены каждые 20 000 км, а если машина новая, то на тех же свечах она может пройти до 150 000 км. Если вовремя менять свечи согласно требованиям технической эксплуатации вашего автомобиля, то можно избежать выхода из строя каталитического нейтрализатора и улучшить работу двигателя.
    • Замена датчика массового расхода воздуха. Эта часть регулирует количество воздуха, которое необходимо для быстрого розжига. Когда он неисправен, то это перерасход топлива, повышенное количество углекислого газа в выхлопе, плохой разгон, снижение мощности двигателя. Чаще всего поломка связана с неправильно установленным воздушным фильтром или срок годности фильтра уже истек. Когда речь идет о замене датчика, то затраты связаны с ценой самого датчика, а вот услуга замены в сервисе стоит не так дорого, потому что не требует много времени и проста по технологии. Регулярная замена фильтра является гарантией долговременной работы датчика .

    Нюансы в работе лампочки «Check engine»

    Лампа «check engine» на панели приборов появилась в начале 90-х годов. но тогда работа датчика была направлена ​​только на контроль работы карбюратора. То есть лампа загорается когда:

    • Произошел засор;
    • Горючая смесь приготовлена ​​неправильно для работы двигателя и т.п.

    Сегодня работа лампочки намного шире. В автомобилях нового образца больше нет карбюраторов. Заменил на форсунки. Именно в связи с этой новинкой в ​​машине лампочка показывает не только неправильную смесь. Благодаря ей водитель узнает о:

    • Перебоях в работе;
    • Проблемы с зажиганием;
    • Плохое переключение передач и многое другое.

    Посмотрите, о чем еще может свидетельствовать горящая лампочка Check Engine (видео)

    Итог

    Таким образом, благодаря такой лампочке на панели можно контролировать практически каждый элемент двигателя, его состояние и работоспособность.

    Индикатор проверки двигателя на панели водителя является индикатором состояния. Если не горит по правилам, то стоит обратить на это внимание и ехать на диагностику. Своевременное устранение поломок – залог безопасности и комфорта в дороге. Внимательность к своему автомобилю исключит поломку в самый неподходящий момент.

    Система смазки двигателя внутреннего сгорания выполняет четыре основные функции: уменьшает силу трения между сопрягаемыми элементами силового агрегата, охлаждает их, защищает от коррозии и очищает от продуктов сгорания топлива и износа.Для выполнения этих функций в двигателе поддерживается определенное давление масла. Слишком малое или слишком большое давление приведет к быстрому износу и разрушению движущихся частей. Контроль давления осуществляется с помощью специального датчика и индикатора (контрольная лампа на приборной панели). Мы расскажем, когда загорается этот индикатор и какие действия должен предпринять автовладелец.

    Как работает индикатор давления масла в ваз 2114/15

    Контрольная лампа указателя давления масла в автомобилях ваз 2114/15 расположена в левом нижнем углу приборной панели и имеет форму масленки.В обычном режиме загорается на несколько секунд при запуске двигателя и гаснет. Лампа является индикатором датчика давления масла, с которым она связана через электронный блок управления двигателем. Датчик установлен в верхней части головки блока цилиндров (на задней части двигателя). Основным элементом является мембрана. При изменении давления он изгибается, замыкая и размыкая контакты. Когда зажигание включено, давление низкое, потому что двигатель еще не работает. Лампа загорается.После запуска силового агрегата начинает работать масляный насос, перекачивая смазку в систему. При этом давление увеличивается, мембрана прогибается и размыкает контакты. Лампа гаснет.

    Горящая лампочка давления масла может указывать на неисправность в системе смазки двигателя.

    Причины, по которым может загораться контрольная лампа

    Контрольная лампа может загораться как во время движения, так и на холостом ходу. Прежде чем делать предположения о причинах возможных неисправностей, следует понаблюдать за поведением лампочки.Если он загорается периодически и только во время движения, проблему следует искать в проводке датчика. Если лампа загорается при работе двигателя на холостом ходу и не гаснет, причиной этого может быть:

    • неисправный датчик давления;
    • низкий уровень масла;
    • слишком жидкое (не соответствующее классу или отработавшее свой ресурс) масло;
    • неисправность масляного насоса;
    • износ масляного фильтра;
    • загрязнение сетки маслоприемника;
    • износ подшипника коленчатого вала.

    Рассмотрим каждую из этих ситуаций подробнее.

    Проводка датчика

    Мигание контрольной лампы во время движения может быть связано с повреждением изоляции провода датчика. Провод под действием вибрации замыкается на «массу» автомобиля, отчего датчик срабатывает. Подобная проблема устраняется тщательным осмотром проводки и заменой поврежденного участка.

    Одной из причин загорания лампочки может быть повреждение проводки датчика давления.

    Датчик

    В автомобилях ВАЗ 2114/15 часто выходит из строя датчик давления масла. Чаще всего именно он является причиной постоянного горения контрольной лампы. Самостоятельно проверить его правильность невозможно. Обычно покупают и устанавливают новый датчик.

    При неисправности датчика давления ВАЗ 2114/15 часто загорается лампа давления масла

    Уровень и качество смазки

    Если контрольная лампа горит постоянно, проверьте уровень масла в масляном поддоне.Делается это специальным щупом на холодном двигателе. Если уровень ниже минимально допустимого, следует добавить вещества и понаблюдать за поведением лампочки. Если он погас, то проблема была именно в недостатке смазки.

    Другой причиной загорания индикатора может быть слишком жидкое масло. Дело в том, что вязкость масла уменьшается с каждым пройденным километром. Если автомобиль проехал без замены масла более 10 тыс. км, масляный насос, рассчитанный на определенную вязкость смазки, не сможет создать необходимое давление.В таких случаях лампочка загорается только тогда, когда двигатель прогревается до рабочей температуры. Это связано с уменьшением вязкости масла из-за нагрева.

    Вязкость масла со временем уменьшается, что приводит к падению давления в системе.

    Эта проблема решается простой заменой масла. Если индикатор продолжает гореть, поиск и устранение неисправностей следует продолжить.

    Измерение давления

    Жидкостный манометр используется для измерения давления масла в системе. Штуцер его шланга вкручивается вместо датчика давления.Сначала измерьте давление холостого хода на прогретом двигателе. Нормальное давление составляет от 1,5 до 2 бар. Затем повторите измерения для высоких оборотов (5000–5500 об/мин). В этом случае оно должно быть не менее 4,5 бар.

    Если манометр показал значения ниже указанных, следует проверить масляный насос, так как именно он создает давление в системе. В этом случае не рекомендуется продолжать эксплуатацию автомобиля.

    Основными неисправностями масляного насоса являются износ его элементов и «залипание» редукционного клапана в открытом положении.В этом случае проще всего заменить насос в комплекте. Сделать это можно как самостоятельно, так и в автосервисе.

    Измерение давления масла жидкостным манометром

    Фильтр

    Если давление масла в норме, проверьте масляный фильтр. Здесь проблемы могут быть вызваны износом или неправильной установкой фильтрующего элемента, а также использованием фильтра, не предусмотренного конструкцией двигателя. Дело в том, что при остановленном двигателе необходимо, чтобы в фильтре оставалось определенное количество масла.Во всех вышеперечисленных случаях смазка будет стекать в картер, что, в свою очередь, вызовет эффект «масляного голодания».

    Масляный фильтр можно заменить самостоятельно. При этом в новый фильтр во избежание «масляного голодания» следует заливать небольшое количество свежего масла.

    При замене нового фильтра обязательно добавьте немного свежего масла.

    Маслоприемник

    Маслоприемник представляет собой устройство, предназначенное для забора масла из масляного поддона и подачи его в насос. Для предотвращения попадания продуктов износа в систему смазки маслоприемник снабжен мелкой металлической сеткой.Загрязнение этого экрана может привести к падению давления масла.

    Для проверки исправности маслоприемника необходимо слить масло из системы и снять масляный поддон. Снять сам маслоприемник достаточно просто. Необходимо открутить три болта, которыми он крепится к элементам картера.

    Если после осмотра маслоприемника выяснится, что сетка забита, ее необходимо прочистить. Для этого замочите все устройство в горячем растворе какого-нибудь бытового чистящего средства (Крот, Комета, Силлит Банг и др.).

    Если все проведенные процедуры не принесли желаемого результата, следует купить и установить новый маслоприемник.

    Со временем забивается сетка маслоприемника, и давление в системе падает.

    Вкладыши

    Давление масла также может упасть, если подшипники сильно изношены. коленчатый вал(коренной, шатунный). Это актуально для автомобилей с большим пробегом. Диагностировать проблему можно только при вскрытии силового агрегата. В этом случае капитальный ремонт двигателя неизбежен.

    Снижение давления масла в системе смазки из-за износа вкладышей коленчатого вала

    Для предотвращения проблем, связанных с падением давления масла, необходимо выполнять следующие рекомендации:

    1. Заливать в двигатель масло, рекомендованное производителя автомобиля, обращая внимание на класс вязкости.
    2. Своевременно меняйте масло и масляный фильтр.
    3. Не используйте для ремонта неоригинальные запасные части.
    4. Не реже одного раза в квартал проводить диагностику системы смазки с обязательным измерением давления.
    5. Если загорается индикатор давления, не эксплуатируйте автомобиль до полной диагностики.

    Игнорирование сигналов указателя давления масла грозит серьезными последствиями для двигателя автомобиля. Любая неисправность системы смазки может привести к капитальному ремонту силового агрегата. Старайтесь поддерживать его в рабочем состоянии и обращайте внимание на все сигналы, подаваемые световым индикатором.

    Датчик положения коленвала ваз 2110. Описание датчика коленвала

    Современное устройство автомобиля, помимо обычного набора узлов и агрегатов, предполагает наличие большого количества электронных устройств, играющих важную роль в эксплуатации автомобиля и соблюдении необходимых параметров безопасности.Датчик положения коленчатого вала, что очень важно для эксплуатации и технического состояния автомобиля.

    При этом следует отметить, что это электронное устройство не выполняет функций управления. Его задача – творческий план, он принимает непосредственное участие в работе газораспределительной системы автомобиля.

    Назначение датчика положения коленчатого вала

    Штатный датчик положения коленчатого вала ВАЗ 2110 предназначен для организации синхронной работы фаз на впрыск топлива и передачи импульсного потока на воспламенение воздушно-капельной смеси в камере сгорания.При снятии этого устройства с системы работы газораспределительного механизма завести автомобиль невозможно.

    В ВАЗ 2110 датчик коленвала работает по принципу индукции электромагнитного поля, а полученная информация передается от шестеренчатого привода шкива генератора, который находится рядом с генератором. Его получает контроллер, который в дальнейшем выдает полученные показатели на бортовое электронное устройство транспортного средства.


    Неисправность датчика коленвала и диагностика

    Такая неисправность датчика коленвала ВАЗ 2110, как полный выход из строя устройства, не дает возможности запустить двигатель данного автомобиля. Однако дефекты меньшего плана приводят к ряду других неисправностей.

    Типы неисправностей:

    • некорректная работа двигателя на малых оборотах;
    • потеря динамических характеристик;
    • самовольное увеличение или уменьшение частоты вращения коленчатого вала;
    • появление вибрации или детонации при увеличении сил нагрузки двигателя;
    • запуск агрегата с перебоями.

    Такие неисправности датчика коленвала ВАЗ 2110 возникают по следующим причинам:

    • дефекты внешней и внутренней обмотки устройства;
    • ударных воздействий на корпус изделия;
    • дефекты проводки, проводов датчика коленвала и соединений в электрической цепи.

    Следует напомнить, что силовое отделение автомобиля подвержено влиянию наиболее разрушительных факторов, к которым относятся различные метеорологические условия, перепады температур, попадание камней и грязи с дорожного покрытия, протечки моторного масла и другие моменты, связанные с дорожное движение… Электрический провод датчика коленвала в идеале всегда должен быть в защитной оболочке, неповрежденный, без грязи и потеков масла.


    Проверка исправности датчика коленвала

    Ошибка датчика коленвала ВАЗ 2110, цена которого относительно приемлемая, а также отказ в работе очень похожи по своим признакам на другие неисправности. Точную диагностику датчика коленвала можно провести, только разобрав нужный прибор.

    Это делается в следующей последовательности:

    • отключить систему зажигания;
    • демонтировать клеммный разъем с проводом датчика коленвала;
    • отвернуть крепления изделия на корпусе масляного насоса;
    • демонтируйте устройство.

    При проведении проверки и диагностики необходим мегомметр для измерения сопротивления обмоток прибора. Если значения измерений не получаются в пределах требуемых 550-570 Ом, делаем вывод о неисправности датчика коленвала ВАЗ 2110, который необходимо заменить.

    По поводу ремонта изделия обращаться в сервисные центры не нужно, такие устройства восстановлению не подлежат. Стоимость такого изделия невысока, поэтому проще приобрести новое устройство и установить вместо него. неисправен датчик . При получении показаний с прибора путем измерения сопротивления в нормальных значениях следует среди прочих причин искать неисправность.


    Замена датчика коленвала

    Такого рода ремонтные работы как замена датчика коленвала ВАЗ 2110 это перечень несложных технических работ, для которых достаточно базовых навыков сантехника.На подготовительном этапе необходимо изначально очистить место проведения работ от грязевых и масляных отложений.

    После снятия изделия на место неисправного вставляется новый элемент, закрепляется штатными креплениями и подсоединяется электрический провод. Эти действия означают, что замена датчика коленвала ВАЗ 2110 закончена и пора приступать к запуску двигателя.

    Современные «десятки» оснащены массой различных узлов и устройств, выполняющих самые разные функции.Датчик коленвала на ВАЗ 2110 является одним из важнейших элементов в автомобиле и напрямую влияет на его работоспособность. Где находится этот датчик? Каковы признаки его неисправности? Как заменить ДПКВ самостоятельно? Подробнее об этом далее в статье.

    На 8- или 16-клапанном двигателе ДПКВ не выполняет функций управления, а синхронизирует фазы для впрыска топлива. Кроме того, датчик коленвала передает импульс на воспламенение топливовоздушной смеси в камере сгорания двигателя, поэтому выход из строя контроллера может привести к несогласованной и некорректной работе различных систем автомобиля, следовательно, нормальный мотор-робот будет невозможен.

    Сам ДПКВ является устройством индуктивного типа. Этот контроллер реагирует на прохождение зубьев на задающем диске, который установлен на шкиве привода генератора, а сам контроллер смонтирован рядом с ним. Стоит отметить, что на шкиве 58 зубьев, между которыми находится двухзубая впадина. Дает возможность синхронизироваться с верхней так называемой «мертвой точкой» поршневого силового агрегата. При прохождении долины возле контроллера, на блок управления мотором подается соответствующий сигнал.


    Конструкций устройств данного типа достаточно много, и принцип их работы основан на датчике Холла. В последнем случае, помимо всего прочего, регулятор реагирует еще и на вращающийся вал, но его работа обусловлена ​​прохождением постоянного магнита.

    Расположение датчика

    Если вы заметили сбои в работе силового агрегата, то прежде чем приступать к выявлению поломки и признаков неисправности, следует выяснить, где находится регулятор.Откройте капот и обратите внимание на крышку масляного насоса. Если у вас 8- или 16-клапанная «десятка», то датчик коленвала будет располагаться непосредственно на ней (крышке маслонасоса). Как видите, расположение регулятора не очень удобное. Разработчики ВАЗа учли этот момент и для удобства замены контроллера оснастили датчик коленвала длинным проводом сантиметров восемьдесят.

    Признаки неисправности датчика


    При выходе из строя контроллера, расположенного на масляном насосе, автовладелец не сможет запустить двигатель.В случае поломки решить проблему невозможности запуска двигателя можно только заменой регулятора. Стоит отметить, что на ВАЗ 2110 контроллер не часто выходит из строя полностью. Как показывает практика, в большинстве случаев проблемы накапливаются постепенно.

    Итак, какие признаки неисправности этого датчика:


    В принципе выход из строя этого контроллера может привести к нестабильной работе силового агрегата. Причины поломки, как правило, связаны с заводским браком.Иногда регулятор выходит из строя в результате загрязнения места установки.

    Омметр для диагностики, процесс диагностики, по каким критериям определяется выход из строя датчика

    Процесс диагностики устройства основан на проверке параметров сопротивления обмоток датчика коленвала, для чего используется омметр. Если при диагностике тестер показал значения, отличающиеся от 550 — 570 Ом, значит контроллер вышел из строя.Во избежание повреждения датчика место установки всегда должно быть чистым. Кроме того, не лишней будет проверка целостности проводки. Качество связи часто играет важную роль. Если говорить о ремонте, то датчик коленвала ремонту не подлежит — его можно только заменить на исправный.

    Инструменты для ремонта

    Для завершения этого события вам понадобится только гаечный ключ на 10.

    Меры предосторожности для предотвращения короткого замыкания

    Во избежание возможного короткого замыкания в бортовой сети автомобиля перед началом работы отсоедините ее от минусовой клеммы аккумуляторной батареи.

    Замена датчика ДПКВ, пошаговая инструкция


    Перед установкой обязательно убедитесь, что проблемы с работой силового агрегата не вызваны некачественной проводкой. В противном случае замена не даст желаемого результата. Кроме того, необходимо очистить разъем и место установки устройства от грязи и пыли, что позволит избежать дальнейших сбоев в его работе.

    Полный список неисправностей, возникших на моей ВАЗ 2110 за 120 000 км эксплуатации.Сначала все шло нормально, когда машина была еще новая. Прошло около года, поломок не было, я даже удивился, как отечественная машина может столько служить и не ломаться.

    Но, не успел я даже подумать об этом, как начались первые поломки и неисправности Десятки. Сначала были проблемы с ходовой, где-то после 40 000 км поменял шаровые опоры так как стуки из подвески стали становиться все сильнее и сильнее. Но это все мелочи, по сравнению с тем, какие неисправности пришлось пережить моим Жигулям.Проблемы начали появляться и расти как снежный ком. Загудели передние ступичные подшипники с левой стороны. Пришлось ехать в сервис и менять. Вслед за этим пришлось менять и правый подшипник, так как неприятный звук начал исходить и с правой стороны.

    Едва я успел отойти от проблем с ходовой, как начались новые проблемы с моей Десяткой. Теперь это были более серьезные неисправности, вроде замены генератора. Заряд аккумулятора пропал и исправить помогла только замена генератора.Потом пришлось менять ремень на генераторе ВАЗ 2110, судя по его состоянию, он бы не протянул и пары дней. Потом я спокойно проехал на своей десятке еще несколько тысяч километров, пока на поворотах, как влево, так и вправо не начали хрустеть приводы, а точнее гранаты (ШРУСы) передних колес. Их замена обошлась мне в автосервисе в 3500 рублей. Сам я не стал заменять ШРУСы, так как раньше с такими проблемами не сталкивался.

    Однажды, поехав в другой город, на трассе порвался ремень ГРМ, и тут я понял, что сделал правильный выбор, когда купил себе Десятку с обычным 8-клапанным двигателем. Его преимущество перед 16-клапанным в том, что при обрыве ремня ГРМ клапана не гнет. Слава Богу, у меня был с собой запасной ремень, как-то с помощью помощников, которые остановились на трассе, чтобы помочь мне, поменял ремень ГРМ и я поехал дальше. Была проблема с ржавыми болтами, но ее решила жидкость WD-40.После этого случая, теперь я всегда ношу ремень с собой, кстати, у меня тоже есть запасной ремень для генератора.

    Замену лампочек и прочих расходников в расчет не беру, так как приходится довольно часто менять лампочки. Я менял масло и фильтр на своей ласточке не так, как написано в инструкции по эксплуатации автомобиля через 10 000 км, а в два раза чаще, то есть через 5 000 км. Просто привычка осталась еще со времен СССР, когда все было как вода, стоило копейки и брать можно было где угодно.Стараюсь лить только Мобил супер полусинтетику, двигатель на ней работает просто супер, тихо и ровно, выхлоп идеально чистый, как на новой машине.

    За весь период эксплуатации неисправности десятой модели участились, стали выходить из строя те детали, которые по идее должны были проработать еще как минимум 5 лет. Например, задние амортизаторы, оба подтекали, хотя я никогда не ездил с тяжелыми грузами и водил машину очень аккуратно, по ямам и плохой дороге всегда ездил спокойно, не более 40 км/ч.Ладно стойки просто стукнули, но нет, протекли, и кроме замены выхода больше не было. Кто владеет десяткой, тот знает, что стоимость этих запчастей очень немаленькая, а если учесть замену, то и получается в два раза дороже.

    После всех этих неприятностей моя десятка начала новую жизнь, проехал уже более 15000 км после последнего ремонта. Поломок больше нет, но состояние кузова оставляет желать лучшего, коррозия не щадит металл отечественной машины… Нижние кромки дверей и крыльев уже совсем желтые, а местами даже сквозная ржавчина.

    Придется поездить так еще год, а потом придется перекрашивать кузов, либо продавать в таком состоянии. Нашему автомобилю не помогает даже антикор, наверное качество антикора такое же как и качество российского металла. Все-таки пришел к выводу, что за те деньги, за которые я брал Десятку, это слишком дорого.А если посмотреть цены на нынешнее десятое семейство украинской сборки Богдан, то меня еще больше удивляют цены на эти автомобили. Как известно, качество сборки украинских Богданов 2110 и 2111 на порядок хуже российской сборки.

    Современный автомобиль, будь то иномарка или отечественный «ВАЗ», очень сложно представить без обилия различных электронных систем. Все они делятся на несколько категорий по своему функционалу.Это может быть система управления двигателем, коробкой передач, ходовой частью и салоном. Что касается первого момента, то одним из компонентов такой системы является датчик коленвала. «ВАЗ-2110» и его последующие модели оснащаются им с конвейера. Что же, давайте рассмотрим особенности этого электронного устройства.

    Характеристика

    Следует отметить, что на автомобилях ВАЗ-2110 датчик коленвала может обозначаться как датчик ВМТ или ДПКВ. Но какой бы аббревиатурой он ни обозначался, безусловно, это единственная деталь, неисправность которой может привести к полной остановке ДВС.

    Назначение датчика положения коленчатого вала

    Основной функцией ДПКВ является синхронизация работы системы зажигания и топливных форсунок. Таким образом, неисправность этого элемента может привести к нестабильной работе системы впрыска автомобиля. Принцип работы заключается в отправке сигналов о положении коленчатого вала на электронный блок управления.

    Устройство и классификация

    Несмотря на то, что датчик коленвала ВАЗ может иметь разную конструкцию, принцип его работы основан на едином электромагнитном воздействии.То есть сигнал формируется без прямого контакта с коленчатым валом.

    Самый распространенный тип ДПКВ — индукционный. Такая деталь состоит из двух основных элементов – намагниченного стержня и специальной обмотки. Индукционные датчики считывают информацию с коленчатого вала. При прохождении металлического зуба вблизи ДПКВ в последнем образуется ЭДС, которая улавливается электроникой. На «ВАЗ-2110» датчик коленвала установлен именно индукционного типа.

    Также ДПКВ может быть основан на эффекте Холла.Такой датчик устроен примерно так же, как и индукционный датчик, однако при прохождении рядом с ним металлического вала в обмотке прибора изменяется сопротивление. Конструктивно он состоит из постоянного магнита.

    Следует отметить, что и первый, и второй тип датчиков используются для считывания данных со шкива коленчатого вала. Он может быть зубчатым и цельнометаллическим. В последнем варианте имеется специальная выемка, которая проходит мимо датчика и формирует сигнал, который подается на электронный блок управления двигателем автомобиля.

    Где устанавливается датчик коленвала на ВАЗ-2110?

    А ДПКВ находится на кронштейне возле шкива привода генератора. Такое расположение устройства очень неудобно для замены, поэтому к нему дополнительно подключается длинный провод с разъемом. Обычно его длина составляет до 70-80 сантиметров. Как выглядит эта деталь вы можете увидеть на фото справа.

    При замене ДПКВ устанавливается зазор между шкивом и самим датчиком.В идеале расстояние между диском синхронизации и сердечником не более полутора миллиметров. Это значение может изменяться в зависимости от расположения прокладок между ДПКВ и седлом.

    Датчик коленвала «ВАЗ-2110»: неисправности и признаки поломок

    Эта деталь может сломаться? Обычно на «ВАЗ-2110» редко выходит из строя датчик коленвала. Однако при его неисправностях (или неправильной работе) загорается красная лампа CHECK ENGINE, что дословно переводится как «проверьте двигатель.В этом случае в памяти ошибок контроллера появляется код 19 или 35.

    Конечно, худший случай при выходе из строя датчика коленвала — это невозможность нормально запустить двигатель. В этом случае можно сказать, что ДПКВ вообще не работает. Решением этой проблемы может быть только полная замена.

    Очень часто датчик положения коленвала выходит из строя постепенно. При этом водитель ощущает значительное падение мощности двигателя, начинаются «провалы» и даже детонация при высоких оборотах… Также признаком неисправности такого устройства могут быть плавающие (нестабильные) обороты двигателя по датчику коленвала, иногда вызывающие повышенный расход топлива. Хотя не исключено, что проблема кроется в слабом контакте или в обрыве провода, в любом случае эту деталь необходимо проверить.

    Устройство диагностики

    Проверка работоспособности датчика положения коленчатого вала осуществляется с помощью специального тестера. Вся диагностика заключается в измерении сопротивления обмотки ДПКВ омметром.Нормальные значения должны быть между 800 и 900 Ом. Если полученные данные неверны, нужно проверить качество соединения контактов. Если это не помогло, приобретается новая деталь. Сама же замена датчика коленвала настолько проста, что с ней справится даже начинающий автомобилист.

    Иногда бывает, что неисправность данного устройства вызвана механическим повреждением обмоток. Такое часто случается при выполнении каких-либо ремонтных работ в подкапотном пространстве автомобиля, либо между зубьями шкива и ДПКВ образуется какой-нибудь посторонний предмет.В связи с этим многие автолюбители рекомендуют возить в багажнике запасной датчик положения. Стоимость на него очень маленькая, но колоссальная для работы двигателя.

    Современные «десятки» оснащены множеством различных электронных устройств и агрегатов, выполняющих различные функции. Одним из важных элементов является датчик коленвала на автомобиле ВАЗ 2110. В этой статье мы подробно расскажем вам о назначении и симптомах неисправности регулятора.

    [Скрыть]

    Описание датчика коленвала

    Так что же это за контроллер и для чего он нужен? Где я могу найти устройство, чтобы заменить его? Каковы основные признаки неисправности устройства? Ответы на эти вопросы мы дадим ниже.

    Функции и назначение

    На двигателе 8 или 16 клапанном ДПКВ предназначен для выполнения нерегулируемых опций, но для синхронизации фаз под впрыск бензина. Также датчик коленвала на ВАЗ 2110 передает импульс для воспламенения топливовоздушной смеси в камерах сгорания силового агрегата. Поэтому в случае поломки контроллера это может привести к тому, что различные системы автомобиля будут функционировать не слаженно. Это означает, что нормальная работа двигателя будет невозможна.

    Датчик коленвала ВАЗ 2110 сам по себе является устройством индуктивного типа, этот контроллер должен реагировать на прохождение зубцов на задающем диске. Этот диск крепится на шкиве привода генератора, а сам контроллер устанавливается рядом с ним. На шкиве 58 зубьев, между которыми полость размером в 2 зубца. Эта впадина обеспечивает синхронизацию с верхней мертвой точкой поршней двигателя. В момент прохождения долины контроллером поступает соответствующий сигнал на блок управления двигателем.

    Конструкций устройств такого типа довольно много, принцип их работы основан на регуляторе типа датчика Холла ВАЗ 2110. В последнем случае регулятор также реагирует на вращающийся вал, но его работа осуществляется в результате прохождения постоянного магнита.

    Где?

    Если в двигателе замечены неисправности, то прежде чем приступать к выявлению поломок и признаков неисправности, необходимо выяснить, где находится регулятор.Где находится датчик положения коленвала на 8- или 16-клапанной «десятке»? Если открыть капот, то можно заметить, что регулятор находится прямо на крышке масляного насоса. Как видите, расположение регулятора не очень удобное. Об этом моменте подумали инженеры ВАЗа, думая об удобстве замены контроллера, поэтому оснастили ДПКВ длинным проводом 80 см.

    Признаки неисправностей

    При выходе из строя контроллера, расположенного на масляном насосе, водитель не сможет запустить двигатель.В случае поломки проблему невозможности запуска мотора решить можно только заменой регулятора. Следует отметить, что на 8- или 16-клапанных двигателях проблема полного выхода из строя контроллера возникает не так часто, как показывает практика, в большинстве случаев проблемы накапливаются.

    Итак, какие симптомы неисправности ДПКВ:

    1. Снижение мощности двигателя во время движения. Когда водитель резко нажимает на газ, можно почувствовать падение мощности. Учтите, что в карбюраторных двигателях это может происходить при неправильной работе ускорительного насоса.
    2. В некоторых случаях может возникнуть детонация двигателя, особенно если он работает на высоких оборотах. Иногда эта проблема может быть вызвана использованием топлива низкого качества.
    3. Двигатель может запускаться с трудом.
    4. Еще одним признаком неисправности, при которой требуется замена датчика коленвала на «десятке» является повышенный расход бензина (автор видео о замене датчика коленвала на отечественных Ладах — канал ИЗО))) ЛЕНТА) .

    Вообще выход из строя этого контроллера может привести к нестабильной работе силового агрегата.Что касается причин, то они, как правило, связаны с заводским браком. В некоторых случаях регулятор выходит из строя из-за загрязнения места установки.

    Диагностика

    Процедура диагностики устройства заключается в проверке параметра сопротивления его обмоток, для этого используется омметр. Если в результате диагностики тестер показал значения, отличные от 550-570 Ом, это говорит о выходе из строя контроллера. Во избежание повреждения датчика место установки всегда должно содержаться в чистоте.Кроме того, не лишним будет проверить целостность проводки, очень часто большую роль играет качество соединений. Что касается ремонта, то ДПКВ ремонту не подлежит, регулятор можно только поменять на исправный.

    Извините, в настоящее время нет доступных опросов.

    Руководство по замене

    Как производится замена датчика положения коленвала ВАЗ 2110? Для выполнения задачи вам понадобится только гаечный ключ на 10.

    Пошаговая инструкция этого процесса представлена ​​ниже:

    1. Сначала нужно выключить зажигание.На всякий случай, во избежание возможных коротких замыканий в бортовой сети автомобиля, можно отсоединить минусовую клемму от аккумуляторной батареи.
    2. Затем откройте капот и найдите местонахождение контроллера. Нужно отсоединить разъем от регулятора.
    3. Ключом на 10 нужно открутить болт, крепящий устройство. Демонтируйте ДПКВ с места установки на крышке масляного насоса, затем замените его новым регулятором. Перед установкой необходимо убедиться, что проблемы в работе силового агрегата не вызваны некачественной проводкой.В противном случае замена не даст требуемых результатов. Очистите разъем и место установки устройства от пыли и грязи, это позволит избежать возможных сбоев в его работе в дальнейшем.

    Интронная мутация в Chd7 создает загадочный сайт сплайсинга, вызывая аберрантный сплайсинг у мышиной модели синдрома CHARGE

    Abstract

    Альтернативный сплайсинг является важным регулятором экспрессии генов у эукариот, однако генетические мутации могут вызывать ошибочный сплайсинг и заболевание.Большинство зарегистрированных нарушений сплайсинга вызваны мутациями донорных/акцепторных сайтов сплайсинга, однако интронные мутации могут влиять на сплайсинг. Клинический анализ экзома в значительной степени игнорирует интронную последовательность, ограничивая обнаружение мутаций кодирующими областями. Мы описываем ‘ Trooper ’, новую мышиную модель синдрома CHARGE с патогенной точечной мутацией в Chd7 . Мутация находится на 18 нуклеотидов выше экзона 10 и создает загадочный акцепторный сайт, вызывая пропуск экзона и частичную задержку интрона.Эта мутация, хотя и обнаруживаемая в экзомной последовательности, изначально была отклонена компьютерной фильтрацией из-за ее интронного расположения. Штамм Trooper проявлял многие из ранее описанных CHARGE-подобных аномалий линий мышей с дефицитом CHD7; включая нарушение слуха, вестибулярную гипоплазию и задержку роста. Однако редко наблюдались более общие черты, такие как асимметрия лица и округление. Распознавание этих характерных особенностей побудило к ручному повторному исследованию последовательности Chd7 и последующей проверке интронной мутации, подчеркнув важность фенотипирования наряду с анализом экзома.Мышь Trooper служит ценной моделью атипичного синдрома CHARGE и раскрывает молекулярный механизм, который может лежать в основе более легкой клинической картины синдрома.

    Введение

    Альтернативный сплайсинг является критическим механизмом регуляции генов, при этом как сборка сплайсосом, так и катализ сохраняются в эукариотических клетках. Когда-то считалось, что простые точечные мутации, вызывающие неправильный сплайсинг мРНК, являются причиной около 15% генетических заболеваний человека, однако расчетные оценки теперь показывают, что более 50% генетических нарушений вызваны аберрантным сплайсингом 1 , 2 .Кроме того, в настоящее время считается, что интронная последовательность содержит критические сигналы, такие как донор сплайсинга (5′), акцептор (3′) и сайты ветвления, которые определяют границы экзона/интрона и запускают правильное удаление некодирующей последовательности из транскриптов мРНК-предшественника для получения зрелая мРНК. Мутации в консенсусных последовательностях могут приводить к скрытой активации сайта сплайсинга, пропуску экзона и задержке интрона или сдвигу рамки считывания, что, в свою очередь, влияет на экспрессию и функциональность генов, приводя к тяжелым заболеваниям, таким как CHARGE-синдром.

    Синдром CHARGE — это редкое заболевание человека, характеризующееся колобомой глаза, пороками сердца, атрезией хоан, задержкой роста, гипоплазией гениталий и аномалиями ушей. В большинстве случаев синдром вызван точечной мутацией в гене хромодомена хеликазной ДНК, связывающей белок 7 ( CHD7 ). Многочисленные патогенные мутации в CHD7 сайтах сплайсинга зарегистрированы у человека, однако их распространенность невелика, что может быть связано со строгими критериями, установленными в пайплайнах экзомного анализа 3 5 .Например, интронные мутации преимущественно считаются патогенными, когда они присутствуют в канонической сплайс-паре донор-акцептор, а мутации за пределами этой интронной области игнорируются как варианты неизвестного значения. Однако растущий объем данных свидетельствует о том, что даже глубокие интронные мутации способны серьезно нарушать экспрессию генов 6 . Здесь мы описываем мышиную модель синдрома CHARGE, несущую точечную мутацию, вызванную мутагенезом этилнитрозомочевины (ENU) в Chd7 .Интересно, что патогенная неканоническая мутация сплайсинга происходит на 16 нуклеотидов выше 3′-сайта сплайсинга AG, однако происходит задержка интрона и пропуск экзона. Мышь Trooper имеет легкий CHARGE-подобный фенотип, демонстрирующий ряд аномалий, включая задержку роста, нарушение слуха и вестибулярную гипоплазию. Таким образом, мышь Trooper является ценной моделью атипичного CHARGE-синдрома человека и молекулярных механизмов, лежащих в основе этого состояния.

    Методы

    Заявление об этике

    Процедуры были одобрены комитетами по этике животных Института Уолтера и Элизы Холл (WEHI) и Детского научно-исследовательского института Мердока (MCRI) в проектах с номерами 2011.016 и A726 соответственно. Все эксперименты проводились в соответствии с Австралийским сводом правил по уходу и использованию животных в научных целях, издание 8 th , 2013 г.

    Мыши

    Колонии мышей содержались в WEHI и MCRI.Мыши, размещенные в MCRI, содержались группами в индивидуально вентилируемых клетках микроизолятора (Tecniplast, Buguggiate, VA, Италия) с циклом 14 часов свет/10 часов темнота. Мыши, размещенные в WEHI, содержались группами в индивидуально вентилируемых клетках микроизолятора (Airlaw, Смитфилд, Новый Южный Уэльс, Австралия) с циклом 12 часов света/12 часов темноты. Животным давали стандартный корм для мышей Barastoc (Ridley AgriProducts, Melbourne, VIC, Australia) и стерилизованную воду ad libitum . Обогащение окружающей среды было предоставлено в виде картонных игрушек и семечек.

    Скрининг мутагенеза

    Самцам мышей BALB/c еженедельно в течение 3 недель в течение 3 недель, как описано ранее, 7 внутрибрюшинно вводили 85 мг/кг этилнитрозомочевины (ENU, Sigma-Aldrich, Castle Hill, NSW, Australia). После 12-недельного периода покоя для восстановления фертильности обработанных самцов подвергали обратному скрещиванию с необработанными самками BALB/c. Полученное потомство (G1) подвергали скринингу с использованием теста на акустическую реакцию вздрагивания (ASR) в возрасте 8 недель. Мышей с ASR ниже 200 мВ в ответ на всплески белого шума с уровнем звукового давления 115 дБ SPL подвергали тестовому скрещиванию для определения наследуемости фенотипа.Штамм Trooper подвергали серийному обратному скрещиванию с BALB/c в течение 15 поколений перед проведением фенотипического анализа.

    Генотипирование

    Геномная ДНК была выделена из ушных пункций, как описано ранее 8 . Мышей генотипировали по мутации Chd7 Trooper с использованием системы HT-генотипирования Amplifluor SNPs FAM-JOE и буферов для оптимизации анализа Amplifluor (S + 25 мМ MgCl) (Merck Millipore, Kilsyth, VIC, Australia) с использованием праймеров GAAGGTGACCAAGTTATTCATGCTGGTCAA дикого типа), GAAGGTGACCAAGTTTCATGCTGGTCAAATGACTTTAGTTCTGATTA (прямой мутант) и TCATAAGGGAGTGAGCACCA (обратный).

    Акустическая реакция вздрагивания

    Для измерения реакции вздрагивания использовали систему SR-LAB plug and play ASR (San Diego Instruments, Сан-Диего, Калифорния, США). Тестирование проводилось в освещенной среде во время световой фазы цикла освещения. Использовали удерживающую камеру из плексигласа, и мышей акклиматизировали к 70 дБ SPL фонового белого шума в течение одной минуты. Щелчки предъявлялись в заранее запрограммированном псевдослучайном порядке и разделялись интервалами от трех до восьми секунд.Каждая мышь прошла шесть испытаний с уровнем звукового давления 70, 85, 90, 95 и 100 дБ и 16 испытаний с уровнем звукового давления 115 дБ (40 мс щелчков белого шума). Самая большая и самая маленькая запись были удалены до того, как была рассчитана средняя амплитуда вздрагивания. Для компиляции данных использовалось программное обеспечение Prism v 6.0b (GraphPad Software Inc, La Jolla, CA, USA).

    Слуховая реакция ствола мозга

    Рабочая станция вызванных потенциалов (Tucker Davis Technologies, Алачуа, Флорида, США) использовалась для оценки слуховой реакции ствола мозга (СОС), как описано ранее 9 .Была использована внутрибрюшинная инъекция 100 мг/кг кетамина и 20 мг/кг ксилазина, анестезированных мышей держали на грелке с защитой глаз с помощью REFRESH в ночное время (Allergan, Новый Южный Уэльс, Австралия). Магнитный динамик в свободном поле (модель FF1, Tucker Davis Technologies) располагали на расстоянии 10  см от левой ушной раковины. Сгенерированные компьютером щелчки (длительностью 100 мкс, со спектром 0–50 кГц) и стимулы чистого тона длительностью 3 мс с частотой 4, 8, 16 и 32 кГц предъявлялись с максимальной интенсивностью 100 дБ УЗД. Подкожные игольчатые электроды (S06666-0, Rochester Electro-Medical, Inc., Лутц, Флорида, США) располагали на верхушке черепа (+ve), левой щеке (-ve) и левой задней лапе (земля). Следы ABR были рассчитаны и проанализированы с использованием среднего значения 512 повторов стимулов в программном обеспечении BioSig (Tucker Davis Technologies). Порог определялся визуальным анализом как стимул самой низкой интенсивности, который воспроизводимо вызывал ABR.

    Идентификация мутаций

    Массивно-параллельное секвенирование

    Секвенирование экзома было завершено Австралийским центром исследования генома (AGRF) с использованием массива захвата экзома 100803_MM9_exome_rebal_2_EZ_HX1 (Roche Nimblegen, Мэдисон, Висконсин, США), набора для подготовки образцов TruSeq, San , Калифорния, США) и HiSeq.2000 Система секвенирования (Illumina) с использованием ДНК, выделенной из двух образцов печени N7 Chd7 +/ Trooper . Группа биоинформатики в Австралийском институте феномики затем использовала специальный конвейер анализа для сопоставления прочтений последовательности с эталонным геномом (C57BL/6 NCBI m37). Вызовы необработанных однонуклеотидных вариантов (SNV) были отфильтрованы, и список кандидатов SNV был создан, как описано 10 .

    Картирование сцепления

    Когорта для картирования была получена путем скрещивания BALB/c- Chd7 +/ Trooper с мышами C57BL/6.В возрасте 8 недель потомство F1 было протестировано на ABR, а потомство с нарушением слуха (порог щелчка > 40 дБ SPL) было скрещено, в результате чего было получено 336 потомков F1N1. Потомство подвергали ABR-тестированию в возрасте 8 недель и подвергали эвтаназии для сбора тканей. Геномную ДНК выделяли из срезов печени, как описано ранее 8 . Двадцать потомков F1N1 с нарушениями слуха (щелчок ABR ≥45 дБ SPL) были генотипированы по 660 SNP, расположенным с интервалом 5–10 Mb по всему геному, с использованием метода iPLEX Gold 11 , MassARRAY System Sequenom, Сан-Диего, Калифорния, США) и масс-спектрометр Autoflex MALDI-TOF (Bruker, Billerica, MA, USA) в AGRF.Гаплотипы были выровнены в Excel версии 14.3.4 (Microsoft, Редмонд, Вашингтон, США) для визуальной идентификации общих областей гетерозиготности.

    Секвенирование по Сэнгеру

    SNV Chd7 Trooper был амплифицирован методом ПЦР из геномной ДНК и секвенирован с использованием праймеров GTCTTGGTCAGGGAAGCAGA и GGATATGAGCTACAGCATTTATTGAA. Капиллярную сепарацию выполняли в AGRF. Программное обеспечение Seqman версии 10.1 (DNASTAR, Мэдисон, Висконсин, США) использовали для выравнивания последовательностей электрофореграмм.

    Транскриптомный анализ

    Мышей подвергали эвтаназии путем смещения шейных позвонков.Мозг немедленно собирали, разрезали пополам и помещали в RNAlater (Life Technologies) на влажном льду. После 12-часовой инкубации при 4° ткань разрушали с помощью ступки и пестика. РНК экстрагировали с использованием набора Quiagen RNEeasy miniKit, а затем синтезировали кДНК с использованием набора для синтеза кДНК SensiFAST™ (Bioline). кДНК амплифицировали методом ПЦР с использованием праймеров CTCTCAGAGATTGAGGATGACCT и TTTTTGCACCTGCTCTTCCG и полимеразы Pfx (Invitrogen) в соответствии с рекомендациями производителей. Очищенные продукты ПЦР лигировали тупым способом в фагмиды pBluescript II, расщепленные EcoRV, и E.coli NEB10-Beta трансформировали с помощью реакций лигирования. Колонии, содержащие вставки, идентифицировали сине-белым скринингом и секвенировали с использованием альтернативного обратного праймера (ACAACCACGTTCAACTCCGT).

    Рентгеновская микрокомпьютерная томография (µCT)

    Мышей подвергали эвтаназии путем смещения шейных позвонков. Улитки отделяли от височных костей и хранили в 4% нейтральном забуференном формалине. Измерения μXCT проводились с использованием Xradia © micro XCT200 (Carl Zeiss X-ray Microscopy, Inc.), в котором используется микрофокусный источник рентгеновского излучения с вращающимся держателем образца и системой детектора изображений. Источником является закрытая рентгеновская трубка (напряжение на трубке 40 кВ, пиковая мощность 10 Вт). Один набор для сбора данных состоял из 361 равноугольной проекции на 180 градусов, обеспечивающей полную томографическую реконструкцию. Время экспозиции составляло 8  секунд для каждой проекции. Томографическое сканирование включало вращение образца во время записи изображений передачи на ПЗС. Каждое проекционное изображение было скорректировано с учетом неравномерного освещения в системе формирования изображения, определяемой путем получения эталонного изображения луча без образца.Алгоритм отфильтрованной обратной проекции используется для получения трехмерного реконструированного изображения. Окончательный размер реконструированного трехмерного изображения составил 512 × 512 ×512 вокселей с размером вокселя 7,6 мкм вдоль каждой стороны и полем зрения (FOV) (3,9 мм) 3 . Для сегментации изображений использовали программу Avizo-6.2 (Mercury Computer Systems Inc., Франция). Визуализация, 3D-моделирование и оценка были выполнены вслепую по генотипу

    Статистический анализ

    Статистический анализ был выполнен в программном обеспечении Prism 6 (GraphPad Software Inc.). Тестирование включало двусторонний ANOVA с апостериорными t-критериями, тестами Уилкоксона-Манна-Уитни и было скорректировано для повторного тестирования с использованием метода Холма Сидака.

    Результаты

    Штамм Trooper появился в результате скрининга мутагенеза ENU, в результате которого были получены многочисленные модели глухоты 9 , 12 , 13 . Мышей-основателей G1 идентифицировали с помощью теста ASR и впоследствии разводили для проверки наследуемости. Фенотип Trooper оказался наследственным по аутосомно-доминантному типу.

    Фенотип

    Trooper вызван мутацией в Chd7

    Хромосомное расположение мутации Chd7 впервые было определено с помощью мейотического картирования. Когорта мышей F1N1 была разделена на группы с нарушением слуха (порог ≥45 дБ SPL) или с нормальным слухом (порог слуха ≤35 дБ SPL) с использованием теста щелчка ABR. Двадцать мышей F1N1 с нарушением слуха были генотипированы по 660 SNP, расположенным через каждые 5–10 Мб по всему геному. Общий общий гаплотип наблюдался проксимально на длинном плече хромосомы 4, между центромерой и rs13477553 (рис.). Это локализовало мутацию Trooper в области 9 Мб между центромерой и rs13477553.

    Мыши Trooper несут интронную точечную мутацию в Chd7 . ( A ) 20 F 1 N 1 мышей классифицировали как слабослышащих по результатам теста Click-ABR (порог  ≥45 дБ SPL). Проиллюстрированы гаплотипы SNP для проксимальной области хромосомы 4, причем числа под каждым гаплотипом представляют количество мышей, наблюдаемых с этим гаплотипом.Область между центромерой и rs13477553 была гетерозиготной у всех мышей с нарушениями слуха. ( B ) Электрофореграммы последовательности ДНК области Chd7 интрона 9 у двух мышей Trooper с нарушениями слуха и здорового однопометника. Обе пораженные мыши были гетерозиготными по мутации c.3219-18T> A в Chd7 , которая, как предполагалось, влияет на сплайсинг.

    Геномная ДНК, полученная из печени двух мышей BALB/c- Chd7 +/ Trooper N7, была подвергнута обогащению экзома и массовому параллельному секвенированию ДНК.Необработанные вызовы вариантов с одним нуклеотидом были отфильтрованы с помощью пользовательского конвейера анализа, чтобы создать список кандидатов SNV для каждой мыши. Однако ни один SNV-кандидат не был возвращен в область минимального сцепления на хромосоме 4. Учитывая, что Chd7 попадали в интервал сцепления и что мышей Trooper демонстрировали фенотипические признаки, сходные с ранее описанными Chd7 Looper мышь 9 повторно исследовали экзомную последовательность Chd7 .Визуальное изучение данных выравнивания последовательностей показало, что точечная мутация в интроне 9 Chd7 (c.3219-18 T > A, эталонная последовательность NCBI {«type»:»entrez-нуклеотид»,»attrs»:{«текст» :»NM_001277149.1″,»term_id»:»460838687″,»term_text»:»NM_001277149.1″}}NM_001277149.1) были обнаружены, но впоследствии отфильтрованы вычислительным конвейером. Секвенирование по Сэнгеру геномной ДНК от слабослышащих и нормальных однопометников подтвердило SNV (рис. ).

    Мутация Trooper создает загадочный сайт сплайсинга

    Для исследования изменений транскриптома была проведена ПЦР-амплификация комплементарной ДНК Chd7 + /Trooper .Гель-электрофорез показал наличие трех транскриптов. Для проверки выполняли молекулярное клонирование мутантных транскриптов на синем/белом экране. ПЦР-секвенирование 44 колоний выявило три разных транскрипта (рис. ), 14 из которых имели пропущенный экзон 10, 6 сохранили часть интрона 10, а 24 были дикого типа (рис. ).

    Мутация Trooper вызывает альтернативные транскрипты Chd7. ( A ) Электрофорез в агарозном геле, иллюстрирующий три продукта ПЦР, полученные на синем/белом экране.Продукты ПЦР окрашивали гель-красным и пропускали через 2,5% агарозу в течение 120 минут при 80 В. ( B ) Схематическое изображение сплайсинга вокруг мутации Trooper в трех ампликонах. Chd7 x сохраняет 16 нуклеотидов интрона 9 сразу после сайта мутации (красная стрелка), что приводит к сдвигу рамки считывания, который затем вызывает преждевременный стоп-кодон в экзоне 10 (красный x). Транскрипт дикого типа присутствует, поскольку мыши являются гетерозиготными по мутации, и самый маленький из транскриптов, Chd7 y , создается путем пропуска экзона 10 и остается в рамке считывания.( C ) Электрофореграммы последовательности трех ампликонов в области мутации Chd7 Trooper .

    Мыши Trooper с дефектами среднего уха и гипоплазией вестибулярного органа

    Для оценки фенотипов, связанных с CHARGE-синдромом, у мышей Trooper , среднее и внутреннее ухо визуализировали с помощью микроКТ. Это было сделано на мышах Trooper с кружащим поведением и без него. Стремечко Chd7 + /Trooper имело деформацию небольшой округлой формы, а между бугорком и слуховой капсулой простирался необычный костный рост.У невращающихся мышей микроКТ-изображение показало, что опорная пластина стремени была деформирована и не контактировала с овальным окном (рис. ). Однако у более сильно пораженного Chd7 + /Trooper (с кружащимся поведением) стременная подножка срослась с овальным окном (рис. ). мкКТ также показала частичное развитие латерального полукружного канала и различные уровни гипоплазии заднего и переднего канала. Место пересечения заднего и верхнего каналов расширено и деформировано.

    Мыши Trooper имеют пороки развития косточек и полукружных каналов. ( A–C ) Рентгенограммы мкКТ левого среднего и внутреннего уха мышей Chd7 + / + и Chd7 + /Trooper (V) и вестибулярного аппарата улитка (С). Передний канал (красная стрелка) гипопластичен, а место пересечения заднего и верхнего каналов (зеленая стрелка) увеличено и деформировано у обеих мышей Chd7 + /Trooper по сравнению с Chd7 + / + управление.( B ) У некруговой мыши Chd7 + /Trooper латеральный полукружный канал (черная стрелка) полный, но гипоплазированный. ( C ) У circling Chd7 + /Trooper латеральный полукружный канал (черная стрелка) неполный. Отсутствующий участок в каждой улитке (*) является артефактом процесса визуализации/реконструкции. n = 1 Chd7 + / + и 2 Chd7 + /Trooper мыши.( D,E ) Альтернативный вид показанного выше среднего уха. Стремя Chd7 + /Trooper было округлым и маленьким, с необычным костным разрастанием, простирающимся от бугорка до слуховой капсулы (серая стрелка), а также была деформирована подножка стремени (фиолетовая стрелка). У невращающегося Trooper подножка была недоразвита и не контактировала с овальным окном, однако у более сильно пораженного Chd7 + / Trooper (с кружащимся поведением) стремечко срослось с овальным окном.

    У лиц с CHARGE гипоплазия полукружных каналов может вызывать вестибулярную арефлексию, приводящую к ухудшению двигательного и речевого развития 14 . У мышей это нарушение проявляется в кивках головой, наклонах и кружении 15 . Эти признаки наблюдались у мышей Trooper , что указывает на нарушение вестибуло-окулярного рефлекса. Однако полная вестибулярная оценка не проводилась.

    Trooper мыши с нарушениями слуха

    ABR пороги Chd7 У мышей + /Trooper была значительно повышена частота между 4 и 16 кГц по сравнению с контрольной группой дикого типа (рис.). Ухудшение слуха было наибольшим на низких частотах со средним сдвигом порога 35–40 дБ SPL на частотах 4 и 8 кГц. Средний пороговый сдвиг в 20 дБ наблюдался на частоте 16 кГц. На частоте 32 кГц у мышей Chd7 + /Trooper было небольшое повышение порога слышимости, однако это не было значительным.

    Мыши Trooper имеют нарушения слуха и нарушения роста. ( A ) Средние пороги ABR у мышей Chd7 + /Trooper (n = 12) и Chd7 + / + (n 12)= 2. Chd7 + /Trooper пороги были значительно повышены на частотах 4,8 и 16 кГц по сравнению с контрольными образцами Chd7 + / + . * p  < 0,001 на основе t-тестов, проведенных с поправкой Холма-Сидака для множественных сравнений. Столбики ошибок = SEM. ( B ) Фотография женщин CHD7 + / + / CHD7 и CHD7 + / + / + / + / + пометки (в 50 дней), иллюстрирующих уменьшенный размер и длина CHD7 +/ Солдат мыши.Масштабная линейка = 3 см. ( C,D ) Средний вес самцов и самок Chd7 + / + (n = 19 самок и 20 самцов) и Chd7 + /Trooper 7 7 2 26 самцы) мышей в возрасте 3–8 недель.

    281787 Мутация Mutation Mutation Lethal

    CHD7

    CHD7 9186 + / Trooper мышей, пересекающиеся с MICE BALB / C, произведенные 277 потомства, состоящие из 148 CHD7 + / + (66 f, 82 м) и 129 Chd7 + / Солдат (71 f, 58 m).Мы ожидали соотношение полов и генотипов 1:1, и не наблюдалось значительного отклонения от этого распределения (двусторонний P = 0,224, с использованием критерия хи-квадрат). Скрещивание мышей Chd7 + /Trooper дало 39 потомков, ни одно из которых не было гомозиготным по мутации (значительно отклоняясь от ожидаемого распределения — двухвостый P = 0,002, с использованием критерия хи-квадрат). 18 мышей были Chd7 + / + (9 f, 9 m) и 21 — Chd7 + /Trooper (14 f, 7 m), что указывает на то, что гомозиготы были эмбрионально вымирающими.Гетерозиготные мыши были фертильны и относительно здоровы, но у них наблюдался дефицит роста (рис. ).

    Обсуждение и выводы

    Мутация Trooper возникла в результате скрининга мутагенеза ENU, предназначенного для выявления мышей с нарушениями слуха. Картирование сцепления, секвенирование экзома и секвенирование по Сэнгеру использовали для точного определения мутации (c.3219-18T > A) в гене хромодоменной хеликазы, связывающей ДНК 7 ( Chd7 ). Мутации в этом гене вызывают у людей характер дефектов, известных под общим названием CHARGE-синдром.CHARGE — это сложное заболевание, поражающее несколько органов с крайней гетерогенностью у разных людей. Точно так же вариабельная фенотипическая пенетрантность является обычным явлением среди многочисленных мышиных моделей CHARGE. Линии мышей с дефицитом CHD7 обычно называют в честь их поразительного поведения по кругу. Примеры, такие как Cyclone , Dizzy 16 , 17 17 17 и Looper 9 9 9 имеют вещественную уборку Особенности ЗАРЯДКИ.С другой стороны, погоня за хвостом практически отсутствует у штамма Trooper . Атрезия хоан и пороки сердца маловероятны, учитывая показатели выживаемости мышей Chd7 + /Trooper после отъема, а распространенные патологии, такие как микрофтальмия и блефароконъюнктивит, наблюдались редко (таблица). Кроме того, Chd7 + /Trooper потеря слуха была менее серьезной, чем при других штаммах (рис. ) 9 .В целом, фенотип Trooper особенно мягкий (таблица). Как и Trooper , атипичный фенотип CHARGE у людей не имеет основных диагностических признаков, таких как пороки сердца и атрезия хоан. Однако потеря слуха, дефицит роста и пороки развития внутреннего уха остаются распространенными 18 . Постоянство пороков развития внутреннего уха при всех формах CHARGE-синдрома подчеркивает, что структурные паттерны в ухе особенно чувствительны к уровням экспрессии CHD7.Действительно, нокдаун CHD7 ингибирует миграцию клеток нервного гребня в глоточные дуги, воздействуя на производные структуры, такие как цепь косточек 19 . На сегодняшний день функциональный анализ CHD7 оказался затруднительным из-за исключительного размера гена (185Kbp, с 42 экзонами, GRCh48.p7, {«type»:»entrez-нуклеотид»,»attrs»:{«text «:»NC_000008.11″,»term_id»:»568815590″,»term_text»:»NC_000008.11″}}NC_000008.11, белок ~ 336 кДа). В результате нет четкого объяснения, почему у некоторых пациентов проявляется более легкая форма заболевания, однако считается, что укороченные мутации CHD7 вызывают более тяжелый фенотип, чем миссенс-мутации 20 .Дефицит CHD7 действительно влияет на клеточную дифференцировку, пролиферацию и миграцию дозоспецифическим образом, что может объяснить некоторые из более мягких фенотипов CHARGE 19 . Однако корреляции генотип-фенотип не существует. Это наиболее очевидно, когда несколько пар братьев и сестер (включая монозиготных близнецов), несущих идентичные мутации, имеют значительные фенотипические различия 5 .

    Таблица 1

    Пенетрантность патологии Trooper по сравнению с патологией Looper .

    5

    Trooper Mice имеют более мягкое слушание фенотип, чем ранее описанный штамм Looper .Средние пороги ABR Chd7 + /Trooper , Chd7 + /Looper и их Chd7 /

    0 + 2. Слух мышей Trooper в среднем значительно лучше, чем у мышей Looper (* p  < 0,002 на основе t-критерия, проведенного с поправкой Холма-Сидака для множественных сравнений). Chd7 +/ Looper и соответствующая контрольная когорта Chd7 + / + были ранее опубликованы в Ogier et al . 9 ).

    Мутация Trooper создает маркер AG в скрытом сайте сплайсинга, который прерывает канонический сплайсинг Chd7 . У эукариот динуклеотиды на 5′ (GT) и 3′ (AG) концах интронной последовательности необходимы для определения положения сайта сплайсинга. Эти маркеры определяют границы экзона и приводят к привлечению сплайсосомы для удаления интрона. Внутри мРНК-предшественника существует множество скрытых сайтов сплайсинга, однако они не используются, если только аутентичный сайт сплайсинга не прерывается мутацией.В более редких случаях, таких как мутация Trooper , интронные сайты сплайсинга de novo 3′ активируются созданием маркера AG в полипиримидиновом тракте 21 . Как правило, активированные криптические сайты сплайсинга находятся в пределах 100 нуклеотидов и выше по течению от аутентичного сайта сплайсинга 22 . Мутация Trooper согласуется с этими наблюдениями и ей предшествует последовательность, богатая пиримидином, которая, вероятно, инициирует сборку сплайсосом.Таким образом, мутация Chd7 +/ Trooper активирует криптический сайт сплайсинга, преждевременно сигнализируя об окончании интрона 9. В результате образуются две аберрантные изоформы.

    Изоформа, которую мы назвали Chd7 x , сохраняет 16 нуклеотидов с 3′-конца интрона 9. Эта вставка вызывает сдвиг рамки считывания, что приводит к преждевременному стоп-кодону в экзоне 10. CHD7 x оканчивается перед геликазой, доменов BRK и SANT и считается нефункциональным.Предсказанное усечение может вызывать нонсенс-опосредованный распад мРНК. Однако присутствие кДНК CHD7 × на синем/белом экране показывает, что продукт не был полностью расщеплен до обратной транскрипции.

    Второй транскрипт, Chd7 y , пропускает экзон 10. Пропуск экзона 10 удаляет большую часть второго из двух хромосомных доменов в CHD7, необходимых для связывания гистонового хвоста. Однако, оставаясь в кадре, Chd7 y , вероятно, избегает деградации мРНК.Вполне возможно, что Chd7 y сохраняет некоторую функцию и, учитывая фенотип Trooper , доминантный негативный эффект маловероятен.

    Атипичная патология CHARGE, наблюдаемая у мышей Chd7 + /Trooper , указывает на то, что одна из альтернативных изоформ сохраняет определенную функциональность или что сплайсосома иногда создает достаточно CHD7 дикого типа для достижения критического порога. Поскольку транскрипт дикого типа Chd7 не был значительно избыточно представлен на сине-белом экране, мы прогнозируем, что CHD7 y сохраняет частичную функциональность с одним хромодоменом.

    Хромодомены представляют собой высококонсервативные структурные компоненты крупных белков, ремоделирующих хроматин, которые регулируют активность генов и организацию генома. Специфическим для белка образом хромодомены присутствуют в тандеме, индивидуально или с родственными «хромотеневыми доменами» 23 Определяющей характеристикой ДНК-связывающих белков хромодоменовой хеликазы является наличие двойных хромодоменов. В то время как механизм связывания гистонов h4 в ремоделёрах хроматина значительно различается между белками, содержащими одиночные и двойные хромодомены, эффективность связывания h4 сопоставима 24 .Следовательно, CHD7 y , вероятно, сохранит способность связывания гистонов, несмотря на делецию С-концевого хромодомена. Вариант сплайсинга CHD7 человека (CHD7s) предоставляет дополнительные доказательства того, что CHD7 y может функционировать без тандемных хромодоменов. В CHD7 отсутствует С-концевой хромодомен, а также геликазный/АТФазный, ДНК-связывающий и домен BRK. CHD7 действуют совместно с CHD7 в ядре и противодействуют CHD7 в нуклеоплазме 25 .Способность CHD7 управлять транскрипцией гена 45S рРНК указывает на то, что N-концевой хромодомен CHD7 функционирует в отсутствие C-концевого хромодомена CHD7. Дальнейший анализ изоформ Trooper CHD7, вероятно, установит функциональную важность хромодоменов в тандемном повторе.

    Появляется все больше свидетельств важности сплайсинга РНК в отношении заболеваний человека, что предполагает практику фильтрации интронных вариантов (неизвестного значения) ограничивает наши возможности диагностировать пациентов.В настоящее время у 30% пациентов с CHARGE отсутствует генетический диагноз. Сообщается, что некоторые хромосомные делеции, одна мутация SEMA3E , одна дупликация RERE и одна мутация KMT2D вызывают CHARGE-подобные атрибуты 26 28 . Однако мутации CHD7 являются преобладающей причиной клинически диагностированного CHARGE 27 . Мы предполагаем, что низкая частота генетической диагностики связана с методологией в диагностических лабораториях, которые, как правило, ограничивают анализ кодирующими экзонами и сайтами сплайсинга динуклеотидов 3 , 5 .Конечно, мутация Trooper будет пропущена с помощью современных методов диагностики, и, поскольку 48 нуклеотидов, ведущих к экзону 10 в Chd7 , сохраняются между видами, мутация может быть патогенной для человека (NCBI ref seq. {«type»:» entrez-нуклеотид»,»attrs»:{«текст»:»NG_007009.1″,»term_id»:»158081724″,»term_text»:»NG_007009.1″}}NG_007009.1). Консервация последовательности этой области также указывает на функциональную значимость за пределами канонического сайта сплайсинга.

    После того, как проекты, основанные на Энциклопедии элементов ДНК (ENCODE), спорно предположили, что 80% человеческого генома имеют биохимические функции, были получены обширные знания, показывающие, что эволюционно динамичная интронная последовательность биологически важна для человека 29 31 .В эпоху быстро развивающейся диагностики с помощью генетического тестирования мышь Trooper является своевременным напоминанием о том, что по мере развития методологии анализа последовательности экзома и генома было бы разумно пересмотреть способы скрининга мутаций в интронах, особенно в последовательности с гомологии с криптическими сайтами сплайсинга.

    Diese Webseite setzt Cookies, über die wir anonyme Daten erheben, wenn Sie die Seite nutzen.Dies geschieht beispielsweise zur Messung und Analyze Ihrer Besuche und Ihrer Nutzung unserer Social-Media-Verbindungen. Wenn Sie diese Webseite nutzen, stimmen Sie der Verwendung von Cookies und ihrer Installation auf Ihrem Endgerät zu. Wenn Sie unter 16 Jahre alt sind und Ihre Zustimmung zu freiwilligen Diensten geben möchten, müssen Sie Ihre Erziehungsberechtigten um Erlaubnis bitten. Мы используем файлы cookie и другие технологии на веб-сайте. Einige von ihnen sind essenziell, während andere uns helfen, diese Website und Ihre Erfahrung zu verbessern.Personenbezogene Daten können verarbeitet werden (z. B. IP-Adressen), z. B. für personalisierte Anzeigen und Inhalte oder Anzeigen- und Inhaltsmessung. Weitere Informationen über die Verwendung Ihrer Daten finden Sie in unserer Datenschutzerklärung. Sie können Ihre Auswahl jederzeit unter Einstellungen widerufen oder anpassen.

    Datenschutzeinstellungen

    Все активы

    Шпайхерн

    Individuelle Datenschutzeinstellungen

    Информация о файлах cookie Datenschutzerklärung Импрессум

    Datenschutzeinstellungen

    Wenn Sie unter 16 Jahre alt sind und Ihre Zustimmung zu freiwilligen Diensten geben möchten, müssen Sie Ihre Erziehungsberechtigten um Erlaubnis bitten.Мы используем файлы cookie и другие технологии на веб-сайте. Einige von ihnen sind essenziell, während andere uns helfen, diese Website und Ihre Erfahrung zu verbessern. Personenbezogene Daten können verarbeitet werden (z. B. IP-Adressen), z. B. für personalisierte Anzeigen und Inhalte oder Anzeigen- und Inhaltsmessung. Weitere Informationen über die Verwendung Ihrer Daten finden Sie in unserer Datenschutzerklärung. Sie können Ihre Auswahl jederzeit unter Einstellungen widerufen oder anpassen.Он нашел Sie eine Übersicht über alle verwendeten Cookies. Sie können Ihre Einwilligung zu ganzen Kategorien geben oder sich weitere Informationen anzeigen lassen und so nur bestimmte Cookies auswählen.

    Datenschutzeinstellungen
    Фенотип Chd7 Солдат Солдат WT Чд7 Лупер Looper WT
    CORMCLING 4% 0% 83% 0%
    (2/52) (0/46) (5 / 6) (0/10)
    Слуховое нарушение 100% 0% 100% 0%
    (12/12) (0/12) ( 18/18) (0/22)
    Полукруговый канал мальформации 100% 0% 100% 0%
    (2/2) (0/1) (3/3) (0/1)
    Blepharoconjountivitis 12% 0% 69% 0%
    (6/52) (0/46 ) (11/16) (0/19)
    Выживаемость после отъема (от общего поголовья семьи) 53% 47% 41% 59% 59%
    (52/98) (46/98) (46/98) (68/167) (99/167)
    Имя Печенье Борлабс
    Анбитер Eigentümer dieser Веб-сайт, Impressum
    Цвек Speichert die Einstellungen der Besucher, die in der Cookie Box от Borlabs Cookie ausgewählt wurden.
    Имя файла cookie borlabs-cookie
    Печенье Laufzeit 1 Яр
    Акцептьерен OpenStreetMap
    Имя OpenStreetMap
    Анбитер Фонд Openstreetmap, Инновационный центр Сент-Джонс, Коули-роуд, Кембридж CB4 0WS, Великобритания
    Цвек Wird verwendet, um OpenStreetMap-Inhalte zu entsperren.
    Datenschutzerklärung https://wiki.osmfoundation.org/wiki/Privacy_Policy
    Хост(ы) .openstreetmap.org
    Имя файла cookie _osm_location, _osm_session, _osm_totp_token, _osm_welcome, _pk_id., _pk_ref., _pk_ses., qos_token
    Печенье Laufzeit 1-10 лет
    .
    Разное

    Добавить комментарий

    Ваш адрес email не будет опубликован.