Продажа квадроциклов, снегоходов и мототехники
second logo
Пн-Чт: 10:00-20:00
Пт-Сб: 10:00-19:00 Вс: выходной

+7 (812) 924 3 942

+7 (911) 924 3 942

Содержание

ГАЗ-53 А ( каталог 1989г.) (53 А)- описание, характеристики, история.

С июня 1969 г. в течение нескольких месяцев выпускали вторую переходную 3,5-тонную модель ГАЗ-53 с новым 8-цилиндровым V-образным карбюраторным двигателем ЗМЗ-53. В июне 1965 г. началось производство 4-тонного грузовика ГАЗ-53А, выпускавшегося до 1982 г.

 

Краткий автомобильный справочник:

Автомобиль ГАЗ-53-07 выпускался Горьковским автомобильным заводом на базе ГАЗ-5ЗА в 1974–1984 гг. Основное топливо — сжиженный нефтяной газ (СНГ), резервное — бензин А-76 (для кратковременной работы).

ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ

Снаряженная масса, кг 3250
В том числе:  
на переднюю ось 1460
на заднюю ось 1790
Полная масса, кг 7400
В том числе:  
на переднюю ось
1810
на заднюю ось 5590
Максимальная скорость, км/ч 80
Контрольный расход газа при 60 км/ч, л/100 км 29,6

Двигатель

Модификация ЗМЗ-53-18 (базовый ЗМЗ-53-11, конвертированный для работы на СНГ) степень сжатия 8,5, мощность 88,3 кВт (120 л. с.) при 3200 об/мин, крутящий момент 284 Н·м (29 кгс·м) при 2200-2500 об/мин.

Газовая система питания

Идентична системе питания автомобиля ГАЗ-52-07 за исключением: газовый баллон полезным объемом 170 л (полный — 190 л), газовый смеситель — СГ-250. Карбюратор резервной системы — однокамерный, горизонтальный, с пламегасителем. Объем бензобака резервной системы 60 л.

 

Автомобили ГАЗ-53-19 и ГАЗ-33075 выпускаются Горьковским автомобильным заводом на базе соответственно ГАЗ-53-12 с 1984 г. и ГАЗ-3307 с 1990 г. Основное топливо — сжиженный нефтяной газ (СНГ), дублирующее — бензин А-76.

ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ

Грузоподъемность, кг 4500 4500
Снаряженная масса, кг 3385 3435
В том числе:    
на переднюю ось 1640 1505
на заднюю ось 1745 1930
Полная масса, кг 8035 8085
В том числе:    
на переднюю ось 1910 1945
на заднюю ось 6125 6140
Максимальная скорость, км/ч 90 90
Контрольный расход газа, л/100 км    
при 60 км/ч 29,6 29,6
при 80 км/ч 40,7 40,7

Двигатель

Модификация ЗМЗ-53-27 (базовый ЗМЗ-53-11, конвертированный для работы на СНГ), мощность 77,2 кВт (105 л.с.) при 3200 об/мин, крутящий момент 255 Н·м 26 кгс·м при 1750-2250 об/мин.

Газовая система питания

Газовый баллон расположен на левом лонжероне рамы, полезный объем — 171 л, полный — 190 л, максимальное рабочее давление 16,0 кгс/см2. Баллон оборудован наполнительным и двумя расходными вентилями (паровой и жидкой фазы) датчиком указателя уровня топлива, заправочным устройством, предохранительным и контрольным клапанами. Газовый редуктор — РЗАА, двухступенчатый, с дозирующе-экономайзерным устройством и пусковым электромагнитным клапаном. Редуктор и испаритель газа (жидкостный) расположены в моторном отсеке. Газовый и бензиновый топливные фильтры снабжены электромагнитными клапанами РС-33601 для отключения подачи газа и бензина с места водителя при помощи переключателя вида топлива П-20А2.

Карбюратор-смеситель — К-126БГ, подача газа — через отверстия в специальной проставке. Бензобак на автомобиле ГАЗ-33075 — специальный, объем 60 л, размещен на левом лонжероне рамы. Указатель давления газа — манометр УК-130, расположен на панели приборов. Датчик давления ММ-358 расположен в первой ступени газового редуктора.

 

Автомобили ГАЗ-53-27 и ГАЗ-33076 ГАЗ-53-27 выпускался Горьковским автомобильным заводом в 1984-1990 гг. на базе ГАЗ-53-12. ГАЗ-33076 выпускается с 1990 г, на базе ГАЗ-3307. Основное топливо — сжатый природный газ (СПГ). дублирующее — бензин А-76.

ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ

Грузоподъемность, кг 4000 4000
Снаряженная масса, кг 3830 3770
В том числе:    
на переднюю ось 1570 1570
на заднюю ось 2260 2200
Полная масса, кг 7980 7920
В том числе:    
на переднюю ось 1920 1820
на заднюю ось 6060 6100
Максимальная скорость, км/ч 80 80
Контрольный расход газа, м3/100 км:    
при 60 км/ч 20,7 20,7
при 80 км/ч 27,80 27,80

Двигатель

Модификация ЗМЗ-53-27 (базовый ЗМЗ-53-11, конвертированный для работы на СПГ), степень сжатия 7,6, мощность 73,5 кВт (100 л.с.) при 3200 об/мин, крутящий момент 236 Н·м (24 кгс·м) при 1750-2250 об/мин.

Газовая система питания

Газовых баллонов - 7, расположены под платформой, рабочее давление - 200 кгс/см2, полный объем заправки газом - 70 м3. Карбюратор-смеситель - К-126БГ. Остальные данные те же, что у ГАЗ-52-27.

ГАЗ-53: технические характеристики

«Рабочая лошадка» советской эпохи

Грузовику ГАЗ-53 суждено было стать самой массовой «рабочей лошадкой» в Советском Союзе. Фирменная «улыбка» радиатора этого трудяги – один из самых узнаваемых «брендов» советской эпохи. Что совсем не удивительно: ведь за годы своего серийного производства, с 1961-го по 1993-й, пятьдесят третий ГАЗон был растиражирован в количестве более четырёх миллионов единиц. И разъехался по всему свету, от Кубы до Камчатки, от Крайнего Севера до джунглей Лаоса и Вьетнама. Далее поговорим о технических характеристиках данного грузовика, выслушаем живые мнения водителей, проработавших на ГАЗ-53 долгие годы.

О сферах применения и модификациях ГАЗ-53

На своих, не особенно могучих, плечах ГАЗ-53 тем не менее «катал» не менее половины всей экономики Страны Советов. Трудно подобрать, где НЕ использовался этот вездесущий грузовик. От «походки» для аварийных бригад и «автозака» для преступников до мобильных топливозаправщиков и седельных тягачей, таскавших контейнеры – что только не устанавливали на шасси ГАЗ-53!

Повсеместное распространение получили эти дешёвые, простые и неприхотливые грузовики в сельском хозяйстве. В 70-е/начале 80-х годов ХХ века в среднестатистическом советском колхозе автопарк грузовых машин на 80% состоял именно из ГАЗ-53. Лишь во второй половине 80-х это соотношение начало изменяться в сторону увеличения доли ЗИЛ-130, который, кстати сказать, в советские времена стоил не намного дороже, чем ГАЗон.

ГАЗ-53 60-х и 80-х годов и внешне заметно отличаются друг от друга, и в технологичном смысле это два довольно разных грузовика. Совершенно разные у них не только двигатели, но и многие другие элементы конструкции.

Ведь за годы выпуска ГАЗ-53 пережил три крупных и множество мелких модернизаций и доработок. Горьковский автозавод старался своевременно реагировать на «сигналы с мест» и устранять выявленные в ходе эксплуатации проблемы.

Так, уже в первые годы распространения новой модели грузовика по стране стало очевидным, что мосты от предыдущего поколения – ГАЗ-51, на 53-й уже не годятся, и 82-сильный двигатель от 51-го ГАЗона, хоть и форсированный, не отвечает возросшим потребностям новой машины. В течение 1964-го/65-го годов было налажено серийное производство ГАЗ-53, оснащённого, вместо рядного шестицилиндрового «движка», V-образной «восьмёркой» (115-сильным мотором ЗМЗ-53), а также доработанными и усиленными мостами.

Интересный, полузабытый факт: облицовка и, соответственно, внешний вид ГАЗ-53 первых выпусков очень заметно отличались от привычного нам облика машины. К примеру, фары находились над указателями поворота. Однако до наших дней, к сожалению, не дожил ни один оригинальный ГАЗон того самого первого поколения. Зато он остался запечатлённым на киноплёнке в некоторых известных фильмах того времени, в частности «Весёлые хлопоты» (1964), «Иностранка» (1965), «Берегись автомобиля» (1966), «Три тополя на Плющихе» (1967).

ГАЗ-53Ф (1961—1967)

Кстати, с ГАЗ-53 уже привычного всем облика связан любопытный кино-курьёз. В знаменитом фильме «Место встречи изменить нельзя», в эпизоде, когда члены банды везут Володю Шарапова в хлебном фургоне ГАЗ-АА по ночной Москве, в некоторые кадры некстати затесался зелёный ГАЗ-53. (Действие фильма происходит в 1946-м году).

«ГАЗ-53А» (1965–1983)

Три основные, базовые модификации грузовика сходили с конвейера под следующими заводскими индексами:

  • ГАЗ-53Ф (1961—1967) – бортовой грузовик и универсальное шасси с форсированным рядным 6-цилиндровым двигателем ГАЗ-51 мощностью 82 л.с.
  • ГАЗ-53А (с июня 1965 года по 1983 год) – бортовой грузовик, самосвал и универсальное шасси с двигателем ЗМЗ-53 – V-образным 8-ми цилиндровым, мощностью в 115 л.с.
  • ГАЗ-53-12 (с 1983 года по январь 1993 года) – бортовой грузовик, самосвал и универсальное шасси с восьмицилиндровым V-образным мотором ЗМЗ-53-11 мощностью в 120 л.с.

Соответственно мощности, различается и грузоподъёмность трёх поколений 53-го ГАЗона. ГАЗ-53Ф был заявлен 4-х тонником, хотя фактически он брал на борт лишь 3 тонны, а 4 т. было для него почти непосильным грузом. Реальным четырёхтонником стал ГАЗ-53А. Мощность мотора ГАЗ-53-12  уже позволяла ему свободно везти не только заявленные производителем 4,5 тонны, но и 5 тонн «с копейками».

ГАЗ-53-12 (1983-1993)

Кроме базовых, существуют сделанные на их основе десятки модификаций и версий ГАЗ-53, предназначенных для использования в специализированных целях. Среди них –

  • Армейская модификация ГАЗ-53Н с дополнительным топливным баком на 105 л, предпусковым подогревателем и комплектом дополнительного оснащения.
  • Получившие широкое распространение автобусы КАвЗ-685 и «Кубань» на базе ГАЗ-53. Они выпускались на шасси ГАЗ-53-40, оснащённом более мягкими рессорами и телескопическими амортизаторами, топливным баком от ГАЗ-66, изменёнными тормозной системой и электрооборудованием.
  • ГАЗ-53-02 – самосвал.
  • Специальное шасси, разработанное под самосвал ГАЗ-САЗ (САЗ-3503).
  • ГАЗ-53-05 – седельный тягач (ширококго распространения не получил, т.к. любой из трёх двигателей 53-го ГАЗона был слабоват для подобных «упражнений»).
  • ГАЗ-53-19 и ГАЗ-53-27 – разработанные в 1984-м году версии, работающие на сжиженном газе; с двигателями в 105 и 100 л.с. соответственно.

Грузовые автомобили ГАЗ-53 экспортировались практически во все страны социализма, а из капиталистических стран – в Финляндию и Бельгию.

Серьёзные сборочные производства этих грузовиков, из советских машинокомплектов, были организованы в Болгарии и на Кубе. Причём болгарское предприятие «Мадара» выпускало ГАЗ-53 на протяжении 1967-1991 годов, доведя в 80-х объём производства до 3000 автомашин в год. А уже с начала 70-х годов – оснащало их двигателями болгарского производства.

Экспортные версии грузовика выпускались с заводскими индексами ГАЗ-53-70 и ГАЗ-53-50 (специально для тропиков). Как уже было отмечено, количество специализированных версий на базе шасси ГАЗ-53 с трудом поддаётся исчислению. Это и передвижные ремонтные мастерские, и пожарные машины, и автокраны, и автолестницы, и мусоровозы, и краны-манипуляторы, и бензовозы-топливзаправщики, и т.д. и т.п.

Об истории легендарного грузовика и его особенностях

В отличие от всех ранее разработанных грузовиков Страны Советов, ГАЗ-53 с изначально создавался сугубо для нужд народного хозяйства. В случае войны его не планировалось мобилизовывать в войска и использовать для транспортировки орудий, перевозки боеприпасов, раненых и т.п. армейских нужд. В связи с этим, ГАЗ-53 с полным правом можно назвать первым отечественным грузовиком «НЕ двойного назначения».

Этим объясняются и «весёленькие» расцветки легендарного автомобиля. Если ранее все грузовики Советского Союза красили только в тёмно-зелёный защитный цвет, то 53-й с самого начала отличался весьма разнообразной цветовой гаммой: кабины его окрашивались в голубой, серый, синий, бежевый, красный, зелёный, жёлтый, оранжевый и некоторые другие цвета.

Прямым «родственником» и «предком» ГАЗ-53 был другой всесоюзный трудяга – грузовик ГАЗ-51. Разработку грузовой автомашины нового поколения возглавлял главный конструктор Горьковского автозавода Александр Дмитриевич Просвирнин (1914-2005). Он, кстати, в 1946-1947 гг. участвовал и в разработке ГАЗ-51, тогда ещё в роли рядового конструктора.

В течение лета/осени 1961 года опытную партию грузовиков ГАЗ-53Ф подвергли серьёзным испытаниям, основным из которых стал автопробег по маршруту Москва – Ташкент – Москва, общей протяженностью в десять тысяч километров. Грузовики в интенсивном режиме прогоняли по просёлочным дорогам и настоящим пустыням, степным пескам, заболоченным почвам и горным местностям. Кульминацией маршрута в Средней Азии стал перевал Шахристан, в Таджикистане, расположенный на высоте более 3,2 тысяч метров над уровнем моря.

Одновременно с этим 2 ГАЗ-53Ф нещадно эксплуатировались в Подмосковье, в условиях бездорожья сельской местности, а еще 4 гоняли по шоссе Москва – Горький туда и обратно, пока на их спидометре не была достигнута цифра 15 000 км., проверяя надёжность на магистральных линиях. В общей сложности, каждая из автомашин выполнила по 18 рейсов.

Кстати, добрых слов заслуживает также «родной брат», 53-го ГАЗона – ГАЗ-52. Тоже бестселлер, выпущенный тиражом более чем в 1 миллион единиц. Это практически его «близнец». Поскольку единственным достоверным различием между данными моделями является модель установленного двигателя: на 52-м – шетицилиндровый рядный, на 53-м – более мощный восьмицилиндровый V-образный.

Между прочим, по наблюдениям опытных водителей ГАЗонов, 52-й отличался несколько лучшей проходимостью в условиях сильного бездорожья или глубокого снега. Более мощный и оборотистый ГАЗ-53 скорее зарывался в грязь, снег или песок там, где 52-й потихоньку проезжал на своей тяге.

Внешне отличить ГАЗ-52 от ГАЗ-53 можно было и по колесным дискам: ГАЗ-52 и модификации имели диски меньшего размера, с 6-ю вентиляционными отверстиями и более узкой резиной. На ГАЗ-53 более широкие (и, соответственно, более «грузоподъемные») шины; колёсные диски большего диаметра, с тремя отверстиями, размещёнными под углом в 120 градусов. Тем не менее, колёсные диски на 52-м и 53-м ГАЗонах являются взаимозаменяемыми.

О технических характеристиках ГАЗ-53

Ознакомившись с фотографиями других автомобилей конца 50-х/начала 60-х годов, можно с полным правом утверждать, что для своего времени внешний вид кабины и её внутренний интерьер ГАЗ-53 выглядели очень прогрессивно.

Была выполнена цельная облицовка решётки радиатора, в которую были органично интегрированы фары и подфарники. Сиденья водителя и пассажира, по канонам тех лет, представляли собой единый «диван». Однако эргономика рабочего места была продумана лучше, чем в ГАЗ-51.

По своему классу ГАЗ-53 относится к семейству универсальных среднетоннажных грузовиков многоцелевого использования. Грузовик ГАЗ-53 имеет рамную конструкцию, привод колёс на задний мост.

Габаритные размеры

  • Длина – 6,395 м; ширина – 2,380 м; высота (по кабине, без нагрузки) – 2,220 м
  • База шасси – 3,700 м; колея передних колёс (по грунту) – 1,630 м; колея задних колёс – 1,690 м
  • Дорожный просвет: 265 мм. При этом нижние точки, с полной нагрузкой составляют: 265 мм (картер ведущего заднего моста) и 347 мм (передняя ось).
  • Размеры грузовой платформы: длина – 3,740 м; ширина – 2,170 м; высота бортов – 0,68 м.
  • Радиус поворота по колее наружного переднего колеса – 8 м.

Эксплуатационные характеристики

  • Колёсная формула: 4х2.
  • Снаряжённая масса: 3,2 тонны.
  • Грузоподъёмность: 4 тонны у ГАЗ-53Ф и ГАЗ-53А; 4,5 тонны – у ГАЗ-53-12.
  • Размер шин: 8,25-20 дюймов.
  • Максимально допустимый вес буксируемого прицепа: 4 тонны.
  • Кабина ГАЗ-53 – металлическая, двухместная, двухдверная.
  • Максимальная скорость с полной нагрузкой по горизонтальному шоссе: 90 км/ч.
  • Ёмкость топливного бака: 90 л (в армейской модификации ГАЗ-53Н — 105 л).
  • Расход топлива от 24-х литров бензина на 100 км.

Несколько слов о характеристиках версии ГАЗ-53-02 (самосвал). ГАЗон-самосвал производился с укороченной в задней части на 27 см рамой. Колёсная база при этом оставалась прежней. Был оборудован валом отбора мощности.

Платформа комплектовалась гидронасосом шестерёнчатого типа, который через систему управляющих клапанов обеспечивал работу трёхзвеньевого гидроцилиндра подъёма кузова. Ёмкость цельнометаллической кузовной платформы – 5 кубометров; подъём кузова и разгрузка предусмотрены как назад, так и вбок.

Двигатели ГАЗ-53

8-цилиндровые 4-х тактные бензиновые карбюраторные моторы ЗМЗ-53 и ЗМЗ-53-11 имеют V-образную компоновку цилиндров. Рабочий объём составляет 4 254 кубических сантиметра. Мощность, при 3200 об. в минуту, составляет: 115 (ЗМЗ-53) и 120 (ЗМЗ-511) лошадиных сил. Диаметр цилиндра – 92 мм; ход поршня – 80 мм. Среднее значение степени сжатия – 6,7. Максимальный крутящий момент при 2000-2500 об/мин составляет 29 кг/см. Цилиндры работают в следующем порядке: 1—5—4—2—6—3—7—8.

Блок цилиндров двигателя выполнен литьём из сплава «Ал-4», а после отливки загерметизирован термической обработкой и пропиткой синтетической смолой. Это классическая моноблочная конструкция V-образной формы с углом по осям цилиндров 90 градусов.

Полости блока и чугунные гильзы под поршни формируют рубашку водяного охлаждения двигателя. Предусмотрена возможность ремонтной замены гильз (5 групп с буквенными обозначениями). С торца блока резьбовыми шпильками закреплен картер механизма сцепления.

Поршни также разделяются на пять ремонтных групп по их диаметру (буквенной маркировкой), и на четыре группы по диаметру отверстий поршневых пальцев (цветовой маркировкой). Поршневая группа отлита из алюминиевого сплава «Ал-30». Поршень имеет классическую круглую форму с плоским днищем, по его диаметру прорезаны три канавки для маслосъёмных и компрессионных колец.

Головки блоков сделаны из сплава «Ал-4». Сёдла клапанов выполнены из чугуна, а направляющие втулки – из медно-графитовой керамики. Блок и головки цилиндров соединены резьбовыми шпильками через прокладки из асбо-картона, армированного сталью. Коленчатый вал отливается из чугуна, на нём формируются шейки шатунов, опоры и противовесы.

Коленвал прошёл через ряд обязательных динамических и статических балансировок. Осевое перемещение коленчатого вала исключают две шайбы, установленные по обе стороны от опоры первой шейки. Герметизируется в блоке с помощью масло-сгонных канавок, сальников и асбестовой набивки.

Механизм газораспределения, с верхней установкой клапанов, обеспечивает впуск в цилиндры топливо-воздушной рабочей смеси и выпуск отработанных газов.

Данное устройство состоит из: распределительных валов и шестерён, толкателей, коромысел, штанг, клапанов, направляющих втулок и пружин. Распределительный вал выкован из стали. Имеет 5 шеек опоры, кулачки, шестерёнчатый привод маслонасоса и распределителя зажигания.

Устройством для приготовления бензо-воздушной смеси является карбюратор марки К-126. Система зажигания – контактная. Свечи зажигания – А11-У.

Система смазки подаёт масло к контактирующим деталям мотора как под давлением, так  и самотёком. Маслонасос – шестерёнчатый, с приводом от распределительного вала, масляный фильтр – полно-поточный, обслуживаемый.

Фильтр подготовки воздуха также обслуживаемый, инерционный, с оседанием загрязняющих частиц в масляной ванне. Система охлаждения – с водяной помпой, закрытого типа, жидкостная. Она состоит из водяной рубашки блока цилиндров, радиатора, помпы, термостата, жалюзи, вентилятора, его кожуха, пробки радиатора и соединительных шлангов. Ёмкость – 22 литра.

Двигатель третьей модификации 53-го ГАЗона – ЗМЗ-53-11 отличается от своего предшественника новыми головками цилиндров с повышенными параметрами сжатия; секционным маслонасосом, полно-поточным фильтрующим устройством, переведённой на закрытую схему вентиляцией картера.

Коробка передач, трансмиссия, тормозная система, ходовая часть, рулевое управление

Коробка передач состоит из четырёх передних «скоростей» и одной задней. По своей конструкции КПП ГАЗ-53 является трёх-ходовой, с синхронизаторами на третьей и четвёртой передачах. Сцепление однодисковое, сухое.

Карданная передача – открытого типа, имеет карданы с игольчатыми подшипниками. Главная передача ведущих мостов – коническая, гипоидного типа, с передаточным числом 6,83. Дифференциал – шестерёнчатый, кулачковый, конический, повышенного трения.

Рессоры – 4 шт., продольные полуэллиптические, концы заделаны в резиновые опоры. Задняя подвеска имеет дополнительные рессоры. Амортизаторы – гидравлические, телескопические, двухстороннего действия.

Ножные тормоза – колодочные, на 4 колеса. Привод тормозов – ножной, гидравлический, с гидро-вакуумным усилителем. Ручной тормоз – центральный, барабанного типа, установлен на ведомом валу коробки передач. Тип рулевого механизма ГАЗ-53 – это глобоидальный червяк с 3х-гребневым роликом.

Электрооборудование ГАЗ-53

В грузовике ГАЗ-53 используется однопроводная система проводки с соединением минусовой клеммы с массой. Напряжение в сети составляет 12 Вольт. Марка «родной» аккумуляторной батареи 6-СТ-68-ЭМ («6» — число последовательно соединенных аккумуляторов в батарее, «СТ» — батарея стартерная, «68» — емкость батареи А/ч, «ЭМ» — материал батареи «мипласт»).

Марка генератора, мощностью 350 Вт – Г130-Г; реле-регулятора – РР130. В систему электрооборудования грузовика ГАЗ-53 также входят катушка зажигания Б13, с дополнительным сопротивлением; прерыватель-распределитель Р13-В; одноцилиндровый компрессор с воздушным охлаждением; электростартер СТ130-Б с дистанционным включением.

Кабина ГАЗ-53

«Комфортабельная 2х-местная кабина закрытого типа, удобное расположение органов управления и приборов, хорошая обзорность, надёжные тормоза, наличие мощного света обеспечивают лёгкость управления автомобилем и безопасность движения на высоких скоростях в любое время суток», — так описывал ГАЗ-53 информационный альбом «ВнешТоргИздата» в 1968-м году.

Что ж, как, говорится, с чем сравнивать. С позиций нашего времени в кабине ГАЗ-53 – более чем аскетичная и спартанская.

Однако, по сравнению с тем же ГАЗ-51, в котором отсутствовали синхронизаторы в коробке передач, перед включением сцепление надо было выжимать 2–3 раза, а кабина была тесной и плохо отапливаемой, 53-й был просто вершиной комфорта!

На двухместном общем сиденье-диване, обтянутом искусственной кожей, при желании легко могли поместиться и три человека. Единственный момент: тот, кому доставалось место в середине, мог немного мешать водителю, задевая рычаг переключения передач ногами. Широкий простор в кабине был и для «творчества» любителей тюнинга: водители советской эпохи украшали свои кабины ГАЗ-53, кто как мог.

Были и умельцы, мастерившие самодельные утепление и шумоизоляцию кабины: набивали её пенопластом, обшивали войлоком, добиваясь поразительной тишины и комфорта на своём рабочем месте.

Отзывы водителей и владельцев ГАЗ-53

Кстати, что говорят люди, которым довелось работать на основном среднетоннажном грузовике союзных республик и стран социализма? Какие достоинства и недостатки они выделят в этой машине?

Из плюсов на первом месте – простота в конструкции и непосредственной эксплуатации машины. На втором – удивительная ремонтопригодность. Для устранения любой мелкой или крупной поломки не требуется наличия каких-то специальных приспособлений, оборудования и инструментов; не нужно быть квалифицированным специалистом. Чтобы полностью перебрать двигатель и КПП, достаточно будет пары дней.

Другой несомненный плюс – стойкость машины при её «убойной» эксплуатации в экстремальных условиях. Чрезвычайно крепкая ходовая часть: всё вокруг может «сгнить» и рассыпаться от старости, а ГАЗоновские ступицы и мосты останутся.

«Задний мост – деталь, которая вообще никогда не подвергалась ремонту, и масла там никто и никогда не менял с 1984-го года, – делится впечатлениями владелец ГАЗ-53, который и по сей день использует его (уже переведённого на газ) в своём хозяйстве, – коррозии практически нет, всё целое».

Действительно, о качестве металла ГАЗонов, выпущенных в 80-х годах, можно говорить только в превосходной степени. На грузовиках следующего поколения металл был уже намного хуже, гораздо более подверженный воздействию коррозии и менее долговечный.

Вообще, средний срок активной эксплуатации грузовика мог быть различным – в зависимости от условий, в которых ему приходилось работать и общего пробега. В колхозах, где «служила», возможно, самая значительная часть 53-х, грузовик работал до своего списания в среднем 12 лет.

Возможности двигателя ГАЗ-53 были весьма ограниченными, и больше положенных по паспорту 4-4,5 тонн он действительно не мог нормально везти. Хотя перегружать его, естественно, пытались часто, везде и повсеместно.

Например, с наращенными бортами грузили зерно с комбайна до семи тонн за раз (вместо четырёх с половиной). Но мощности мотора с великим трудом хватало для того, чтобы справиться с высокой нагрузкой. Гружёный «по полной» или «с припуском» ГАЗон тянет очень плохо, даже в не очень крутую горку нужно «карабкаться» на первой передаче, также мотор начинает перегреваться.

В условиях нещадной эксплуатации двигатели ГАЗ-53 работали всего по 100-150 тысяч километров до первого капитального ремонта; там, где условия были более благоприятные – и по 400 тысяч. Капремонт мотора можно было делать не менее трёх раз.

Слабое место в конструкции ГАЗона – диск сцепления, шлицов хватает всего на один сезон интенсивной работы. Опорный подшипник в коленчатом вале также больше сезона не всегда выдерживал; отмечают и проблемы с выжимным подшипником.

Рулевое управление – механическое, тугое, иногда «бьющее по рукам». Но ни о каких усилителях в те времена ещё и речи не было. Другой минус – большой расход топлива – в советскую эпоху также был несущественным.

Сейчас это уже трудно представить, но тогда бензин стоил дешевле минералки: в 70-х годах 6-8 копеек за литр; в 80-х уже дороже, однако и тогда абсолютный максимум стоимости бензина составлял 30 копеек за литр. Поэтому ГАЗ-53, переведённые с бензина на газ стали уже «детищем перестройки».

Цены на ГАЗ-53

Несмотря на то, что грузовики ГАЗ-53 не производятся уже четверть века, на дорогах СНГ и на вторичном рынке и теперь можно встретить немало этих автомашин.

Цена, в зависимости от состояния автомобиля, варьируется от совершенно «копеечных» 30 тысяч до 150 тысяч, за грузовик на ходу, в рабочем состоянии. Никаких проблем с запчастями для ГАЗ-53 нет: они также в избытке имеются на вторичном рынке.

 

 

 

Самосвал ГАЗ-53: технические характеристики, размеры кузова | цена

ГАЗ-53 — советский среднетоннажный грузовик, выпускавшийся в различных модификациях. Сегодня автомобиль не утратил популярности у пользователей, благодаря ремонтопригодности, низкой стоимости комплектующих и впечатляющему сроку службы.

ГАЗ-53: история

Серийный выпуск ГАЗ-53 начался в 1961 году. На протяжении следующих тридцати с лишним лет автомобиль производили в различных версиях, меняя индексы в названии. В 1993 году завершилось серийное изготовление ГАЗ-53 на модели ГАЗ-53-12. Автомобили производили на мощностях Горьковского завода. Технику относят к третьему поколению ГАЗ.

За годы серийного производства было выпущено более четырех миллионов единиц техники. Специалисты признают ГАЗ-53 самым массовым автомобилем в СССР. Интересно отметить, что технические данные машин практически не менялись на протяжении всего периода изготовления. Основные изменения касались дизайна кабины и устройства панели приборов. Последняя версия наружной облицовки была впервые выпущена в 1984 году. Первые ГАЗ-53 были похожи на классический ЗИЛ-130.

 Самосвал ГАЗ-53: технические характеристики

Ремонтопригодный и в меру надежный ГАЗ-53 с самосвальным механизмом продолжает работать в частных и коммерческих хозяйствах. Достаточно прочный кузов оснащается автоматическим устройством подъема. Зависимая рессорная подвеска обеспечивает жесткость хода, которая на переднем мосту смягчается телескопическими амортизаторами. На автомобиле используется тормозной механизм барабанного типа. Гидроусилитель руля отсутствует, что усложняет управление.

К недостаткам машины специалисты относят малый ресурс сцепления, что влияет на плавное начало движения. Крепление кардана требует постоянного внимания, так как гайки в местах соединения с шарнирами постоянно откручиваются. Одна из главных проблем — текущий сальник коленвала. Электрооборудование машины не отличается надежностью. ГАЗ-53 с загруженным кузовом плохо адаптирован для движения по разбитым дорогам.

Двигатель и трансмиссия

На протяжении долгого периода серийного выпуска ГАЗ-53 самосвал оснащался различными моторами. Первым силовым агрегатом стал двигатель ГАЗ-11 , 6-цилиндровый 82-сильный мотор, дополненный четырехступенчатой трансмиссией. Автомобиль, укомплектованный такими узлами, разгонялся до 74 км/ч, имел максимальную грузоподъемность 3,5 тонны и расходовал от 22 до 25 л топлива на 100 км.

На следующих модификациях ГАЗ-53 с индексом А устанавливались моторы ЗМЗ-53. Шестицилиндровый двигатель выдавал 115 л.с. мощности и дополнялся четырехступенчатой коробкой переключения передач. Максимальная скорость движения машины достигла 85 км/ч, грузоподъемность и расход топлива не изменились. В 1983 году выпуск таких машин был завершен.

Последний ГАЗ-53-12 оснащался силовым агрегатом ЗМЗ-511. Восьмицилиндровый мотор выдавал 120 л.с. мощности. На максимальной скорости машина расходовала 25-30 литров топлива на 100 км. Грузоподъемность техники увеличилась до 4,5 тонн.

«Прожорливые» силовые агрегаты считаются одной из основных проблем эксплуатации ГАЗ-53. Однако советское машиностроение решило эту проблему. На автомобиль можно установить дизельный двигатель Д-245. Агрегат окупается по грубым подсчетам за 40 тысяч километров.

Некоторые модели ГАЗ-53 выпускались с газобаллонным оборудованием и могли работать на метане. Мощность такой техники составляла 100-105 л.с., а максимальная скорость достигала 80 км/ч.

Размеры кузова ГАЗ-53

  • длина — 6395 мм;
  • ширина — 2280 мм;
  • высота 2190 мм;
  • продольная база — 3700 мм;
  • дорожный просвет — 265 мм;
  • масса — 3200 кг.

Получите выгодное предложение от прямых поставщиков:

Вам будет интересно

Технические характеристики ГАЗ-53, история модификаций модели, узлы и детали силовой установки

В 60-х годах прошедшего века завод, именуемый сегодня «Группа ГАЗ», приступил к производству среднетоннажных грузовых автомобилей.

На грузовики устанавливались новые силовые агрегаты, механизмы трансмиссии, кабина и кузов, органы управления.

Модели серий 52, 53, 66 образовали линейку универсальных грузовиков, которые в интересах народного хозяйства обеспечивали перевозку в промышленности, для сельскохозяйственных и строительных нужд.

Модификации и история выпуска

Автомобиль являлся самым массовым грузовиком союзных республик. На дорогах страны работало 4 млн машин в обычном, самосвальном и специализированном исполнении.

В 1961-1967 гг. производился ГАЗ-53Ф. Шестицилиндровый на 82 л. с. мотор ГАЗ-11 с четырехступенчатой коробкой переключения скоростей обеспечивали перевозку 3 500 кг груза, потребляя на пробег в 100 км 24 литра низкооктанового бензина.

К планируемому времени выпуска модели не было в производстве V-образного восьмицилиндрового силового агрегата.

Для 53Ф форсировали шестицилиндровый ГАЗ-11, увеличив сжатие смеси. Не было готового гипоидного заднего моста, поэтому поставили механизм с коническими шестернями от модели 51A (автомобиль изображен на фото).

Объективно, по своим техническим характеристикам, автомобиль ГАЗ-53Ф являлся переходной моделью между серией 51A (с нагрузкой 2 500 кг) и серией САЗ-53Б (с грузоподъемностью на тонну больше), что достигалось увеличенной до 3,7 м базой и новыми шинами 8,25-20, монтируемыми на стальные диски.

Автомобиль использовали не только в качестве самосвала, но также была распространена ассенизаторская машина, бензовозы и молоковозы.

ГАЗ-53 не являлся законченной конструкцией, из-за частых выходов из строя деталей и механизмов не имел популярности среди водителей и работников ремонтных служб автотранспортных предприятий. Грузовик с явно слабым мотором и ненадежным мостом выпускался до 1967 года.

С 1964 по 1983 год на дороги выходили модели серий 53 и 53А с грузовой нагрузкой 3 500 и 4 000 кг. Более мощный силовой агрегат ЗМЗ-53 на 115 л. с. обеспечил увеличение скоростного параметра до 85 км/ч при потреблении бензина 25 литров на 100 км.

Отличия линейки 53А от 53

Модели автомобиля имеют следующие отличия:

  • усиленная передняя ось;
  • новая конструкция кардана;
  • более надежная конструкция рулевого привода;
  • новая решетка радиатора;
  • сигналы поворота дублируются повторителями на крыльях кабины;
  • наличие стеклоочистителей с электроприводом;
  • отопление кабины.

В 1973 г. модель 53А отметили Государственным знаком качества СССР.
Расширяя функциональные возможности машины, было налажено изготовление шасси 53 01 под крытые кузова и спецоборудование.

Шасси 53 02 являлось платформой для применения кузова самосвального типа и оборудовалось устройством снятия мощности для гидравлического насоса.

На экспорт шли грузовики моделей 53 50 и 53 70. Машины охотно приобретались в Бельгии, Финляндии, в соцстранах. В Болгарии и на Кубе осуществлялась сборка грузовиков из комплектов, поступающих с ГАЗа.

Модель 53 12 производилась с 1983 по 1992 год, как дальнейшее развитие 53-й линейки. В грузовик был установлен восьмицилиндровый мотор ЗМЗ-511.

Мощностной параметр в 120 л. с. позволил довести нагрузку до 4,5 т, а скоростной показатель – до 90 км/ч.

Потребление бензина повысилось до 30 литров, но была предусмотрена возможность установки оборудования для заправки сжиженным или сжатым газом.

Технические характеристики базового бортового автомобиля ГАЗ-53:

Показатель

Ед. изм.

Значение

Период производства  

1964-1983 гг.

Предельный размер по габариту (длина, ширина, высота)

 

мм

6 395, 2 380, 2 220

Расход топлива

л/100 км

24

Мест всего  

3

Нагрузка

кг

4 000

Вес с полной загрузкой

кг

7 400

База между колесными осями

мм

3 700

Просвет до грунта минимальный

мм

265

Скорость

км/ч

до 85

Силовой агрегат  

ЗМЗ-53

Механизм сцепления  

один диск, сухого типа, с рычажным приводом

КПП  

на четыре ступени

Передача заднего моста главная  

одинарная, коническая, гипоидная

Рулевая колонка  

червяк глобоидной формы и ролик на три гребня

Размерность шин  

8,25-20

Устройство тормозов  

механизм барабанного типа по всем осям, с гидравлическим приводом

 

Дизельный двигатель автомобиля

Двигатель на грузовике ГАЗ-53 (ЗМЗ-53) V-образный, восьмицилиндровый (два ряда по четыре цилиндра), карбюраторного типа, работает по четырехтактному циклу.


Рабочий объем цилиндров ДВС автомобиля ГАЗ-53 – 4,25 л (при размере цилиндров в поперечном сечении 92 мм и ходах поршня 80 мм).

Технические характеристики по мощности 115 л. с. Запуск мотора ГАЗ-53 осуществляется при помощи стартера.

Номинальные обороты коленчатого вала в минуту – 3 200. Степень сжатия смеси – 6,7.

Системы и механизмы

Блок цилиндров выполнен литьем из сплава Ал-4, после отливки герметизирован термической обработкой и пропиткой синтетической смолой. Это моноблочная конструкция V-образной формы с углом по осям цилиндров 90 градусов.

Полости блока и чугунные гильзы под поршни формируют рубашку водяного охлаждения двигателя. Предусмотрена возможность ремонтной замены гильз (5 групп с буквенными обозначениями). С торца блока резьбовыми шпильками закреплен картер механизма сцепления.

Поршневая группа отливается из сплава алюминия Ал-30. Поршень круглой формы с плоским днищем, в его теле прорезаны три канавки для маслосъемных и компрессионных колец.

Поршни делятся на 5 ремонтных групп по собственному диаметру (буквенная маркировка) и на 4 группы по диаметру отверстия поршневого пальца (цветовая маркировка).

Головки блоков выполнены из сплава Ал-4. Седла клапанов из чугуна, направляющие втулки – из медно-графитовой керамики. Блок и головки цилиндров соединяются резьбовыми шпильками через прокладки из асбокартона, армированного сталью.

Коленчатый вал отлит из чугуна, на нем сформированы шейки шатунов, опоры и противовесы. Вал проходит динамическую и статическую балансировку.

Осевое перемещение коленвала исключают две шайбы, установленные по обе стороны от опоры первой шейки. Герметизируется в блоке маслосгонными канавками, сальниками и асбестовой набивкой.

Механизм газораспределения с верхней установкой клапанов обеспечивает впуск в цилиндры рабочей смеси и выпуск отработанного газа.

Устройство состоит из: распределительных валов и шестерен, толкателей, коромысел, штанг, клапанов, направляющих втулок и пружин.

Распределительный вал куется из стали. Имеет пять шеек опоры, кулачки, шестеренчатый привод маслонасоса и распределителя зажигания.

В систему питания входят: бензобак на 90 л, трубопроводы, диафрагменный насос с механическим приводом, фильтрующие устройства очистки топлива и двухкамерный карбюратор К-126 – устройство для приготовления бензовоздушной смеси.

Система смазки подает масло к трущимся деталям под давлением и самотеком. Маслонасос шестеренчатый с приводом от распредвала, масляный фильтр полнопоточный, обслуживаемый.

Фильтр подготовки воздуха обслуживаемый, инерционный, с оседанием загрязняющих частиц в масляной ванне.

Система охлаждения с водяной помпой, закрытого типа, жидкостная. Она состоит из водяной рубашки блока цилиндров, радиатора, помпы, термостата, жалюзи, вентилятора, его кожуха, пробки радиатора и соединительных шлангов. Емкость – 22 литра. Система зажигания контактная.

Модель 53 12

Грузовик предназначен для транспортировки грузов весом до 4 500 кг по асфальту и грунтовым дорогам. Машина допускала эксплуатацию при температуре от +40 до -40º C.

Вариант 53 12 является глубокой модернизацией модели 53А с лучшими показателями по экономии горючего, ремонтным регламентам и безопасности.

Повышение мощности силовой установки, применение новых радиальных шин позволило увеличить динамику и проходимость машины.

Автомобили серий 53 27 и 53 19 работали на сжатом и сжиженном газе.

Силовой агрегат ЗМЗ-53-11 получил секционный маслонасос, полнопоточное фильтрующее устройство, новые головки цилиндров с повышенным параметром сжатия, вентиляция картера была переведена на закрытую схему.

У автомобиля были усилены: рессорная подвеска, рамные элементы, поперечина (балка) оси. Удалось на 19% уменьшить токсичность выхлопа.

В дальнейшем автомобиль оборудуется триплексом переднего обзора, бесконтактной системой зажигания, новой светотехникой, аварийными сигналами, гидровакуумным усилителем с распределением давления торможения по осям.

Самосвал

Грузовик выпускался для транспортировки сыпучих грузов в интересах сельского хозяйства и промышленности. За счет гидравлической системы механизировался процесс разгрузки.

Емкость цельнометаллической кузовной платформы – 5 кубометров. Специальный механизм допускает механическую выгрузку на одну из рабочих сторон.

Производился самосвал на шасси ГАЗ-53 02 с укороченной в задней части на 270 мм рамой. Колесная база при этом оставалась прежней. Оборудовался валом отбора мощности.

Платформа комплектовалась гидронасосом шестеренчатого типа, который через систему управляющих клапанов обеспечивал работу трех звеньевого гидроцилиндра подъема кузова.

Задние сцепное и буксировочное устройства были перемещены на боковые части рамы.

Проблемные вопросы всей серии

Серия автомобилей имеет следующие недостатки:

  • малый ресурс сцепления и тормозной системы;
  • значительный расход топлива;
  • ненадежные: соединение частей карданной передачи, распределитель и вариатор катушки зажигания;
  • течь сальника заднего коренного подшипника двигателя.

Среднетоннажный грузовик 53-й серии показал себя технически простым, надежным автомобилем, легким в управлении. Долговечные, с неброским дизайном автомобили можно и сейчас встретить на сельских дорогах регионов.

Машина может обслуживаться и ремонтироваться в гараже частного подворья, в сельской мастерской, в «поле». Запчасти на автомобиль дешевы и недефицитны.

При замене масла и фильтрующих элементов в регламентные сроки ресурс двигателя до капремонта может превысить 400 тыс. км.

И в заключении посмотрим видео тест-драйва грузовика ГАЗ-53, а также узнаем мнение экспертов о технических характеристиках автомобиля:

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Двигатель газ 53 – характеристики, модификации, особенности opex.ru

Array
(
    [DATE_ACTIVE_FROM] => 27.01.2020 09:17:00
    [~DATE_ACTIVE_FROM] => 27.01.2020 09:17:00
    [ID] => 509136235
    [~ID] => 509136235
    [NAME] => Двигатель газ 53 – характеристики, модификации, особенности
    [~NAME] => Двигатель газ 53 – характеристики, модификации, особенности
    [IBLOCK_ID] => 33
    [~IBLOCK_ID] => 33
    [IBLOCK_SECTION_ID] => 
    [~IBLOCK_SECTION_ID] => 
    [DETAIL_TEXT] => 
	 
	

На современном автомобильном рынке можно найти огромное количество товара для транспортных средств. При этом в ассортименте встречаются запчасти, устройства и целые системы как надлежащего качества, так и не очень. В принципе это неудивительно, так как компании стараются заработать больше денег при меньших вложениях в производство — в этом вся суть экономики.

Среди большого разнообразия автомобильной продукции особо выделяется двигатель ГАЗ 53, который отличается высоким качеством исполнения и надежной сборкой. Впервые мотор был выпущен в 1961 году, и за это время претерпел ряд изменений, которые только улучшили конструкцию устройства и сделали его более эффективным.

Все о характеристиках

На грузовиках ГАЗ 53 используют силовые агрегаты марки ЗМЗ 53. Среди характеристик выделяют:

  1. Тип устройства — бензиновый мотор, оборудованный V8.
  2. Объем — 4,25 л.
  3. Максимальный момент вращения вала — 295 Н/м.
  4. Вес — 262 кг.
  5. Марка используемого топлива — А-76.

Помимо ГАЗ 53 двигатель также используют на других моделях транспортных средств популярного завода.

Конструкция

Преимущество двигателя ГАЗ 53 — это улучшенный потенциал и увеличенный КПД. За основу для изготовления силового агрегата был взят стандартный карбюратор, работа которого требует использования топлива.

Особенность конструкции обновленного мотора — V-образное размещение цилиндров, в которых осуществляется перемещение и обработка топлива. Они установлены в двигателе, и между ними образован небольшой угол, что и делает конструкцию такой интересной. С помощью этого решения производителям удалось улучшить мощность агрегата и получить требуемый крутящий момент. Клапаны устройства расположены в верхней части.

Конструкторы двигателя не остановились на достигнутом и использовали обновленные и улучшенные головки цилиндров, в которых предусмотрена турбулентная камера. Она оборудована выпускным клапаном в форме винта, что и позволило добиться повышения КПД и компрессии устройства.

Дополнительно мотор оснастили особой системой, которая организует повторное использование отработавших газов. Такое решение положительно сказывается на экологических характеристиках двигателя.

Конструкция мотора также включает следующие элементы:

  • коробку передач;
  • систему смазки;
  • систему охлаждения.

Относительно последней стоит сказать, что она работает просто отлично. Жидкость внутри устройства циркулирует по остальным системам машины, что позволяет добиться комфортной эксплуатации автомобиля в любую погоду.

Какие существуют модификации двигателя?

Существует несколько разновидностей двигателя ГАЗ 53. Их не так уж много. Объясняется это тем, что во время выпуска силового агрегата не особо стремились к созданию разнообразных конструкций. За основу всегда брали знакомый ЗМЗ 53.

Выделяют следующие модификации:

  1. ЗМЗ 6606. Отличается ходом поршня, показатель которого достигает 92 мм. Диаметр составляет 80 мм. Такая конструкция позволяет добиться мощности в 120 лошадиных сил. Объем двигателя такой же, как у стандартной модели.
  2. ЗМЗ 511. Такие же показатели хода поршня и его диаметра, как у первого варианта модификации. Объем двигателя составляет 4,25 литра, что позволяет достичь мощности в 125 лошадиных сил.
  3. ЗМЗ 523. Конструкторы увеличили объем двигателя, достигнув значения в 4,68 литра. Максимальная мощность составляет 130 лошадей. Диаметр хода поршня 88 мм, ход элемента не изменился.

Существуют другие модификации, но они не получили широкого распространения. Среди силовых агрегатов стоит выделить ЗМЗ 5233, 5234 и 513. На моделях ГАЗ они встречаются крайне редко.

Обслуживание

У двигателя ГАЗ 53 неплохой ресурс. Мотор отличается высоким уровнем выносливости. Он обеспечивает длительный срок эксплуатации транспортного средства, практически не подвергается частым поломкам и не выходит из строя.

Чтобы увеличить эксплуатационный ресурс двигателя, следует регулярно проводить техническое обслуживание мотора. Оно включает в себя следующие работы:

  • Регулярную замену моторного масла. Оптимальный показатель для замены — это прохождение транспортным средством свыше 6 тыс. км. В качестве моторного масла специалисты рекомендуют применять минеральный тип состава или полусинтетику. Такие жидкости подходят для УАЗов и Волг.
  • Настройку положения головки блоков, подтяжку крепежных элементов коллектора. Последний известен, как паук. Процедуру рекомендуется выполнять каждые 1-2 тыс. км пробега автомобиля. Если в процессе эксплуатации была заменена прокладка ГБЦ или ремонт другого элемента системы, процедура является обязательной. Стоит учесть, что выполнение подтяжки следует проводить, когда двигатель остынет.
  • Проверять и регулировать уровень жидкости в системе охлаждения. Эта процедура способна перейти в разряд ежедневных. Особенно важно это делать летом, так как повышение температуры способно вызвать перегрев двигателя. Ремонт охлаждающей системы мотора стоит дорого. Поэтому, если не хочется переплачивать за ошибку, следует ответственно отнестись к данному пункту.
  • Регулировать положение клапанов. От того, как установлен клапан, зависит работоспособность мотора и величина компрессии в процессе эксплуатации. Сразу стоит отметить, что газораспределительная система собрана качественно, поэтому каждый день настраивать клапаны не нужно. В основном процедуру рекомендуют проводить после замены прокладок головки блока цилиндров.
  • Контролировать уровень масла, которое находится в емкости внутреннего сгорания. В основном это касается владельцев Волг и УАЗов. Подобная процедура проводится для обеспечения элементов и механизмов необходимым количеством смазывающей жидкости во время эксплуатации транспортного средства. Для отслеживания внутри емкости предусмотрен уровень, который позволит вовремя определить недостаток масла и долить его.
  • Проводить внешний осмотр автомобиля. Дело в том, что во время поездок могут произойти разные поломки, одна из которых способна привести к образованию течи масла из двигателя. Многие утверждают, что это одна из главных проблем двигателя, которая требует решения. Если течь была обнаружена, необходимо как можно быстрее принять меры по ее устранению.

Дополнительно опытные водители и мастера рекомендуют периодически разбирать силовой агрегат, чтобы проверить его работоспособность и состояние. Разборка и сборка осуществляются посредством использования набора ключей. Для проведения работ потребуется опыт, поэтому начинающим водителям лучше обратиться за помощью профессионалов.

Для замены масла потребуется выполнить следующие действия:

  1. Демонтировать крышку горловины емкости и снять ее.
  2. Снять пробку, которая закрывает сливное отверстие.
  3. Дождаться, пока стечет масло. Предварительно рекомендуется подставить под горловое отверстие заранее подготовленную емкость.
  4. Удалить фильтр и заменить его на деталь.
  5. Залить небольшое количество жидкости в полость обновленного фильтра.
  6. Залить моторное масло в емкость силового агрегата.

Далее необходимо запустить мотор и дать ему прогреться. Это поможет ускорить распределение масла по всем механизмам конструкции. Последний шаг заключается в проверке наличия протечек. Если их нет, замену топливной жидкости можно считать успешно завершенной. Если они присутствуют, необходимо устранить протечку и долить масло до нужного уровня.

Возможные неисправности

К распространенным поломкам ГАЗ 53, которые возникают в процессе эксплуатации транспортного средства, относят:

  1. Увеличение расхода топлива. В основном проблема возникает из-за того, что масло начинает вытекать через соединения элементов или сальники.
  2. Стук во время работы шатунного вкладыша. Причиной возникновения поломки является недостаточный уровень масла или износ деталей.
  3. Стук поршня. Главная причина – поломка юбки и перегородки механизма. Также стук может возникнуть из-за того, что прогорело днище.
  4. Прогорание прокладок. Опасная ситуация, сообщающает о том, что произошел перегрев деталей.
  5. Прогорание выпускного клапана. Происходит из-за использования бензина низкого качества.

Любая поломка требует ремонта или замены. Игнорирование ситуации может привести к выходу из строя механизма, системы или двигателя в целом.

Тюнинг

Сегодня грузовики ГАЗ уже не выпускают, а машины этой серии, продолжающие двигаться по дорогам, требуют доработок и модернизации конструкции. Объясняется это тем, что автомобиль уже не выглядит таким, каким был во времена Советского Союза. Поэтому владельцы транспортных средств прибегают к разным видам тюнинга, чтобы вернуть красоту грузовику и улучшить его эксплуатационные характеристики.

Модернизация двигателя

Самый распространенный вариант тюнинга — это улучшение двигателя, который используется в машине. Прежде всего, потребуется полностью поменять старый мотор на агрегат, у которого будет большая часть следующих преимуществ:

  • небольшой расход топлива;
  • длительный срок службы, позволяющий эксплуатировать устройство до 400 тыс. км пробега;
  • простота в обслуживании;
  • высокий КПД.

Установка такого мотора сделает поездку на грузовике более комфортной и быстрой. Если было принято решение менять силовой агрегат, то необходимо выполнить:

  1. Демонтаж предыдущего мотора.
  2. Сварку креплений на раме.
  3. Замену системы выхлопа, емкости топливного бака и проводки.

Также потребуется переделать карданный вал и поменять переходники устройства.

Модернизация кабины

После того, как будет обновлен двигатель, можно приступить к улучшению внутреннего пространства. Стоит отметить, что первоначальный вариант кабины не отличается особым изыском и комфортом. Внутри все выполнено с использованием простого пластика и металла большой толщины. Поэтому водители принимают решение о внесении ряда изменений для организации комфортного передвижения.

Возможные варианты модернизации:

  • прикрепление плафона от иномарки;
  • установка центрального замка;
  • монтаж сигнализации.

Дополнительно выполняют замену обивки сидений, установку современных приборных панелей и других устройств, способных сделать передвижение на транспортном средстве удобным.

Модернизация трансмиссии

Такой вариант тюнинга заслуживает отдельного внимания. Для обновления трансмиссии можно воспользоваться задним мостом от ГАЗ 3307 и установить конструкцию на автомобиль, который подвергается тюнингу. Результатом станет улучшения конструкция подвески, в которой предусмотрена автоматическая блокировка заднего моста.

Примечательно, что некоторые способны превратить классический ГАЗ 53 в настоящий пикап, установив в нем силовой агрегат объемом свыше 5 литров.

[~DETAIL_TEXT] =>

На современном автомобильном рынке можно найти огромное количество товара для транспортных средств. При этом в ассортименте встречаются запчасти, устройства и целые системы как надлежащего качества, так и не очень. В принципе это неудивительно, так как компании стараются заработать больше денег при меньших вложениях в производство — в этом вся суть экономики.

Среди большого разнообразия автомобильной продукции особо выделяется двигатель ГАЗ 53, который отличается высоким качеством исполнения и надежной сборкой. Впервые мотор был выпущен в 1961 году, и за это время претерпел ряд изменений, которые только улучшили конструкцию устройства и сделали его более эффективным.

Все о характеристиках

На грузовиках ГАЗ 53 используют силовые агрегаты марки ЗМЗ 53. Среди характеристик выделяют:

  1. Тип устройства — бензиновый мотор, оборудованный V8.
  2. Объем — 4,25 л.
  3. Максимальный момент вращения вала — 295 Н/м.
  4. Вес — 262 кг.
  5. Марка используемого топлива — А-76.

Помимо ГАЗ 53 двигатель также используют на других моделях транспортных средств популярного завода.

Конструкция

Преимущество двигателя ГАЗ 53 — это улучшенный потенциал и увеличенный КПД. За основу для изготовления силового агрегата был взят стандартный карбюратор, работа которого требует использования топлива.

Особенность конструкции обновленного мотора — V-образное размещение цилиндров, в которых осуществляется перемещение и обработка топлива. Они установлены в двигателе, и между ними образован небольшой угол, что и делает конструкцию такой интересной. С помощью этого решения производителям удалось улучшить мощность агрегата и получить требуемый крутящий момент. Клапаны устройства расположены в верхней части.

Конструкторы двигателя не остановились на достигнутом и использовали обновленные и улучшенные головки цилиндров, в которых предусмотрена турбулентная камера. Она оборудована выпускным клапаном в форме винта, что и позволило добиться повышения КПД и компрессии устройства.

Дополнительно мотор оснастили особой системой, которая организует повторное использование отработавших газов. Такое решение положительно сказывается на экологических характеристиках двигателя.

Конструкция мотора также включает следующие элементы:

  • коробку передач;
  • систему смазки;
  • систему охлаждения.

Относительно последней стоит сказать, что она работает просто отлично. Жидкость внутри устройства циркулирует по остальным системам машины, что позволяет добиться комфортной эксплуатации автомобиля в любую погоду.

Какие существуют модификации двигателя?

Существует несколько разновидностей двигателя ГАЗ 53. Их не так уж много. Объясняется это тем, что во время выпуска силового агрегата не особо стремились к созданию разнообразных конструкций. За основу всегда брали знакомый ЗМЗ 53.

Выделяют следующие модификации:

  1. ЗМЗ 6606. Отличается ходом поршня, показатель которого достигает 92 мм. Диаметр составляет 80 мм. Такая конструкция позволяет добиться мощности в 120 лошадиных сил. Объем двигателя такой же, как у стандартной модели.
  2. ЗМЗ 511. Такие же показатели хода поршня и его диаметра, как у первого варианта модификации. Объем двигателя составляет 4,25 литра, что позволяет достичь мощности в 125 лошадиных сил.
  3. ЗМЗ 523. Конструкторы увеличили объем двигателя, достигнув значения в 4,68 литра. Максимальная мощность составляет 130 лошадей. Диаметр хода поршня 88 мм, ход элемента не изменился.

Существуют другие модификации, но они не получили широкого распространения. Среди силовых агрегатов стоит выделить ЗМЗ 5233, 5234 и 513. На моделях ГАЗ они встречаются крайне редко.

Обслуживание

У двигателя ГАЗ 53 неплохой ресурс. Мотор отличается высоким уровнем выносливости. Он обеспечивает длительный срок эксплуатации транспортного средства, практически не подвергается частым поломкам и не выходит из строя.

Чтобы увеличить эксплуатационный ресурс двигателя, следует регулярно проводить техническое обслуживание мотора. Оно включает в себя следующие работы:

  • Регулярную замену моторного масла. Оптимальный показатель для замены — это прохождение транспортным средством свыше 6 тыс. км. В качестве моторного масла специалисты рекомендуют применять минеральный тип состава или полусинтетику. Такие жидкости подходят для УАЗов и Волг.
  • Настройку положения головки блоков, подтяжку крепежных элементов коллектора. Последний известен, как паук. Процедуру рекомендуется выполнять каждые 1-2 тыс. км пробега автомобиля. Если в процессе эксплуатации была заменена прокладка ГБЦ или ремонт другого элемента системы, процедура является обязательной. Стоит учесть, что выполнение подтяжки следует проводить, когда двигатель остынет.
  • Проверять и регулировать уровень жидкости в системе охлаждения. Эта процедура способна перейти в разряд ежедневных. Особенно важно это делать летом, так как повышение температуры способно вызвать перегрев двигателя. Ремонт охлаждающей системы мотора стоит дорого. Поэтому, если не хочется переплачивать за ошибку, следует ответственно отнестись к данному пункту.
  • Регулировать положение клапанов. От того, как установлен клапан, зависит работоспособность мотора и величина компрессии в процессе эксплуатации. Сразу стоит отметить, что газораспределительная система собрана качественно, поэтому каждый день настраивать клапаны не нужно. В основном процедуру рекомендуют проводить после замены прокладок головки блока цилиндров.
  • Контролировать уровень масла, которое находится в емкости внутреннего сгорания. В основном это касается владельцев Волг и УАЗов. Подобная процедура проводится для обеспечения элементов и механизмов необходимым количеством смазывающей жидкости во время эксплуатации транспортного средства. Для отслеживания внутри емкости предусмотрен уровень, который позволит вовремя определить недостаток масла и долить его.
  • Проводить внешний осмотр автомобиля. Дело в том, что во время поездок могут произойти разные поломки, одна из которых способна привести к образованию течи масла из двигателя. Многие утверждают, что это одна из главных проблем двигателя, которая требует решения. Если течь была обнаружена, необходимо как можно быстрее принять меры по ее устранению.

Дополнительно опытные водители и мастера рекомендуют периодически разбирать силовой агрегат, чтобы проверить его работоспособность и состояние. Разборка и сборка осуществляются посредством использования набора ключей. Для проведения работ потребуется опыт, поэтому начинающим водителям лучше обратиться за помощью профессионалов.

Для замены масла потребуется выполнить следующие действия:

  1. Демонтировать крышку горловины емкости и снять ее.
  2. Снять пробку, которая закрывает сливное отверстие.
  3. Дождаться, пока стечет масло. Предварительно рекомендуется подставить под горловое отверстие заранее подготовленную емкость.
  4. Удалить фильтр и заменить его на деталь.
  5. Залить небольшое количество жидкости в полость обновленного фильтра.
  6. Залить моторное масло в емкость силового агрегата.

Далее необходимо запустить мотор и дать ему прогреться. Это поможет ускорить распределение масла по всем механизмам конструкции. Последний шаг заключается в проверке наличия протечек. Если их нет, замену топливной жидкости можно считать успешно завершенной. Если они присутствуют, необходимо устранить протечку и долить масло до нужного уровня.

Возможные неисправности

К распространенным поломкам ГАЗ 53, которые возникают в процессе эксплуатации транспортного средства, относят:

  1. Увеличение расхода топлива. В основном проблема возникает из-за того, что масло начинает вытекать через соединения элементов или сальники.
  2. Стук во время работы шатунного вкладыша. Причиной возникновения поломки является недостаточный уровень масла или износ деталей.
  3. Стук поршня. Главная причина – поломка юбки и перегородки механизма. Также стук может возникнуть из-за того, что прогорело днище.
  4. Прогорание прокладок. Опасная ситуация, сообщающает о том, что произошел перегрев деталей.
  5. Прогорание выпускного клапана. Происходит из-за использования бензина низкого качества.

Любая поломка требует ремонта или замены. Игнорирование ситуации может привести к выходу из строя механизма, системы или двигателя в целом.

Тюнинг

Сегодня грузовики ГАЗ уже не выпускают, а машины этой серии, продолжающие двигаться по дорогам, требуют доработок и модернизации конструкции. Объясняется это тем, что автомобиль уже не выглядит таким, каким был во времена Советского Союза. Поэтому владельцы транспортных средств прибегают к разным видам тюнинга, чтобы вернуть красоту грузовику и улучшить его эксплуатационные характеристики.

Модернизация двигателя

Самый распространенный вариант тюнинга — это улучшение двигателя, который используется в машине. Прежде всего, потребуется полностью поменять старый мотор на агрегат, у которого будет большая часть следующих преимуществ:

  • небольшой расход топлива;
  • длительный срок службы, позволяющий эксплуатировать устройство до 400 тыс. км пробега;
  • простота в обслуживании;
  • высокий КПД.

Установка такого мотора сделает поездку на грузовике более комфортной и быстрой. Если было принято решение менять силовой агрегат, то необходимо выполнить:

  1. Демонтаж предыдущего мотора.
  2. Сварку креплений на раме.
  3. Замену системы выхлопа, емкости топливного бака и проводки.

Также потребуется переделать карданный вал и поменять переходники устройства.

Модернизация кабины

После того, как будет обновлен двигатель, можно приступить к улучшению внутреннего пространства. Стоит отметить, что первоначальный вариант кабины не отличается особым изыском и комфортом. Внутри все выполнено с использованием простого пластика и металла большой толщины. Поэтому водители принимают решение о внесении ряда изменений для организации комфортного передвижения.

Возможные варианты модернизации:

  • прикрепление плафона от иномарки;
  • установка центрального замка;
  • монтаж сигнализации.

Дополнительно выполняют замену обивки сидений, установку современных приборных панелей и других устройств, способных сделать передвижение на транспортном средстве удобным.

Модернизация трансмиссии

Такой вариант тюнинга заслуживает отдельного внимания. Для обновления трансмиссии можно воспользоваться задним мостом от ГАЗ 3307 и установить конструкцию на автомобиль, который подвергается тюнингу. Результатом станет улучшения конструкция подвески, в которой предусмотрена автоматическая блокировка заднего моста.

Примечательно, что некоторые способны превратить классический ГАЗ 53 в настоящий пикап, установив в нем силовой агрегат объемом свыше 5 литров.

[DETAIL_TEXT_TYPE] => html [~DETAIL_TEXT_TYPE] => html [PREVIEW_TEXT] =>

Двигатель ГАЗ 53 — мощный и надежный агрегат, пользующийся популярностью. В статье внимательно рассмотрено, почему он так нравится владельцам грузовиков.

[~PREVIEW_TEXT] =>

Двигатель ГАЗ 53 — мощный и надежный агрегат, пользующийся популярностью. В статье внимательно рассмотрено, почему он так нравится владельцам грузовиков.

[PREVIEW_TEXT_TYPE] => html [~PREVIEW_TEXT_TYPE] => html [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [TIMESTAMP_X] => 29.01.2020 10:41:18 [~TIMESTAMP_X] => 29.01.2020 10:41:18 [ACTIVE_FROM] => 27.01.2020 09:17:00 [~ACTIVE_FROM] => 27.01.2020 09:17:00 [LIST_PAGE_URL] => /press/articles/ [~LIST_PAGE_URL] => /press/articles/ [DETAIL_PAGE_URL] => /press/articles/dvigatel-gaz-53/ [~DETAIL_PAGE_URL] => /press/articles/dvigatel-gaz-53/ [LANG_DIR] => / [~LANG_DIR] => / [CODE] => dvigatel-gaz-53 [~CODE] => dvigatel-gaz-53 [EXTERNAL_ID] => 509136235 [~EXTERNAL_ID] => 509136235 [IBLOCK_TYPE_ID] => content [~IBLOCK_TYPE_ID] => content [IBLOCK_CODE] => articles [~IBLOCK_CODE] => articles [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 [NAV_RESULT] => [DISPLAY_ACTIVE_FROM] => 27.01.2020 [IPROPERTY_VALUES] => Array ( [SECTION_META_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_META_KEYWORDS] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_META_DESCRIPTION] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_PAGE_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_META_KEYWORDS] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_PAGE_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_PICTURE_FILE_ALT] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_PICTURE_FILE_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_DETAIL_PICTURE_FILE_ALT] => Двигатель газ 53 – характеристики, модификации, особенности [SECTION_DETAIL_PICTURE_FILE_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_PREVIEW_PICTURE_FILE_ALT] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_PREVIEW_PICTURE_FILE_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_DETAIL_PICTURE_FILE_ALT] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_DETAIL_PICTURE_FILE_TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_META_TITLE] => Все, что нужно знать о двигателе ГАЗ 53. [ELEMENT_META_DESCRIPTION] => В статье рассказывается о том, что представляет собой двигатель, какие у него характеристики, модификации и особенности. Также приводятся примеры распространенных поломок. ) [FIELDS] => Array ( [DATE_ACTIVE_FROM] => 27.01.2020 09:17:00 ) [DISPLAY_PROPERTIES] => Array ( ) [IBLOCK] => Array ( [ID] => 33 [~ID] => 33 [TIMESTAMP_X] => 29.04.2021 14:36:58 [~TIMESTAMP_X] => 29.04.2021 14:36:58 [IBLOCK_TYPE_ID] => content [~IBLOCK_TYPE_ID] => content [LID] => s1 [~LID] => s1 [CODE] => articles [~CODE] => articles [API_CODE] => [~API_CODE] => [NAME] => Статьи [~NAME] => Статьи [ACTIVE] => Y [~ACTIVE] => Y [SORT] => 500 [~SORT] => 500 [LIST_PAGE_URL] => /press/articles/ [~LIST_PAGE_URL] => /press/articles/ [DETAIL_PAGE_URL] => #SITE_DIR#press/articles/#ELEMENT_CODE#/ [~DETAIL_PAGE_URL] => #SITE_DIR#press/articles/#ELEMENT_CODE#/ [SECTION_PAGE_URL] => [~SECTION_PAGE_URL] => [CANONICAL_PAGE_URL] => [~CANONICAL_PAGE_URL] => [PICTURE] => [~PICTURE] => [DESCRIPTION] => [~DESCRIPTION] => [DESCRIPTION_TYPE] => text [~DESCRIPTION_TYPE] => text [RSS_TTL] => 24 [~RSS_TTL] => 24 [RSS_ACTIVE] => N [~RSS_ACTIVE] => N [RSS_FILE_ACTIVE] => N [~RSS_FILE_ACTIVE] => N [RSS_FILE_LIMIT] => 10 [~RSS_FILE_LIMIT] => 10 [RSS_FILE_DAYS] => 7 [~RSS_FILE_DAYS] => 7 [RSS_YANDEX_ACTIVE] => N [~RSS_YANDEX_ACTIVE] => N [XML_ID] => [~XML_ID] => [TMP_ID] => bb54a993677d00c7337704f59ed12453 [~TMP_ID] => bb54a993677d00c7337704f59ed12453 [INDEX_ELEMENT] => Y [~INDEX_ELEMENT] => Y [INDEX_SECTION] => Y [~INDEX_SECTION] => Y [WORKFLOW] => N [~WORKFLOW] => N [BIZPROC] => N [~BIZPROC] => N [SECTION_CHOOSER] => L [~SECTION_CHOOSER] => L [LIST_MODE] => [~LIST_MODE] => [RIGHTS_MODE] => S [~RIGHTS_MODE] => S [SECTION_PROPERTY] => N [~SECTION_PROPERTY] => N [PROPERTY_INDEX] => N [~PROPERTY_INDEX] => N [VERSION] => 2 [~VERSION] => 2 [LAST_CONV_ELEMENT] => 0 [~LAST_CONV_ELEMENT] => 0 [SOCNET_GROUP_ID] => [~SOCNET_GROUP_ID] => [EDIT_FILE_BEFORE] => [~EDIT_FILE_BEFORE] => [EDIT_FILE_AFTER] => [~EDIT_FILE_AFTER] => [SECTIONS_NAME] => Разделы [~SECTIONS_NAME] => Разделы [SECTION_NAME] => Раздел [~SECTION_NAME] => Раздел [ELEMENTS_NAME] => Элементы [~ELEMENTS_NAME] => Элементы [ELEMENT_NAME] => Элемент [~ELEMENT_NAME] => Элемент [REST_ON] => N [~REST_ON] => N [EXTERNAL_ID] => [~EXTERNAL_ID] => [LANG_DIR] => / [~LANG_DIR] => / [SERVER_NAME] => www.opex.ru [~SERVER_NAME] => www.opex.ru ) [SECTION] => Array ( [PATH] => Array ( ) ) [SECTION_URL] => [META_TAGS] => Array ( [TITLE] => Двигатель газ 53 – характеристики, модификации, особенности [ELEMENT_CHAIN] => Двигатель газ 53 – характеристики, модификации, особенности [BROWSER_TITLE] => Все, что нужно знать о двигателе ГАЗ 53. [KEYWORDS] => Двигатель газ 53 – характеристики, модификации, особенности [DESCRIPTION] => В статье рассказывается о том, что представляет собой двигатель, какие у него характеристики, модификации и особенности. Также приводятся примеры распространенных поломок. ) [IMAGES] => Array ( ) [FILES] => Array ( ) [VIDEO] => Array ( ) [LINKS] => Array ( ) [BUTTON] => Array ( [SHOW_BUTTON] => [BUTTON_ACTION] => [BUTTON_LINK] => [BUTTON_TARGET] => [BUTTON_JS_CLASS] => [BUTTON_TITLE] => ) )

На современном автомобильном рынке можно найти огромное количество товара для транспортных средств. При этом в ассортименте встречаются запчасти, устройства и целые системы как надлежащего качества, так и не очень. В принципе это неудивительно, так как компании стараются заработать больше денег при меньших вложениях в производство — в этом вся суть экономики.

Среди большого разнообразия автомобильной продукции особо выделяется двигатель ГАЗ 53, который отличается высоким качеством исполнения и надежной сборкой. Впервые мотор был выпущен в 1961 году, и за это время претерпел ряд изменений, которые только улучшили конструкцию устройства и сделали его более эффективным.

Все о характеристиках

На грузовиках ГАЗ 53 используют силовые агрегаты марки ЗМЗ 53. Среди характеристик выделяют:

  1. Тип устройства — бензиновый мотор, оборудованный V8.
  2. Объем — 4,25 л.
  3. Максимальный момент вращения вала — 295 Н/м.
  4. Вес — 262 кг.
  5. Марка используемого топлива — А-76.

Помимо ГАЗ 53 двигатель также используют на других моделях транспортных средств популярного завода.

Конструкция

Преимущество двигателя ГАЗ 53 — это улучшенный потенциал и увеличенный КПД. За основу для изготовления силового агрегата был взят стандартный карбюратор, работа которого требует использования топлива.

Особенность конструкции обновленного мотора — V-образное размещение цилиндров, в которых осуществляется перемещение и обработка топлива. Они установлены в двигателе, и между ними образован небольшой угол, что и делает конструкцию такой интересной. С помощью этого решения производителям удалось улучшить мощность агрегата и получить требуемый крутящий момент. Клапаны устройства расположены в верхней части.

Конструкторы двигателя не остановились на достигнутом и использовали обновленные и улучшенные головки цилиндров, в которых предусмотрена турбулентная камера. Она оборудована выпускным клапаном в форме винта, что и позволило добиться повышения КПД и компрессии устройства.

Дополнительно мотор оснастили особой системой, которая организует повторное использование отработавших газов. Такое решение положительно сказывается на экологических характеристиках двигателя.

Конструкция мотора также включает следующие элементы:

  • коробку передач;
  • систему смазки;
  • систему охлаждения.

Относительно последней стоит сказать, что она работает просто отлично. Жидкость внутри устройства циркулирует по остальным системам машины, что позволяет добиться комфортной эксплуатации автомобиля в любую погоду.

Какие существуют модификации двигателя?

Существует несколько разновидностей двигателя ГАЗ 53. Их не так уж много. Объясняется это тем, что во время выпуска силового агрегата не особо стремились к созданию разнообразных конструкций. За основу всегда брали знакомый ЗМЗ 53.

Выделяют следующие модификации:

  1. ЗМЗ 6606. Отличается ходом поршня, показатель которого достигает 92 мм. Диаметр составляет 80 мм. Такая конструкция позволяет добиться мощности в 120 лошадиных сил. Объем двигателя такой же, как у стандартной модели.
  2. ЗМЗ 511. Такие же показатели хода поршня и его диаметра, как у первого варианта модификации. Объем двигателя составляет 4,25 литра, что позволяет достичь мощности в 125 лошадиных сил.
  3. ЗМЗ 523. Конструкторы увеличили объем двигателя, достигнув значения в 4,68 литра. Максимальная мощность составляет 130 лошадей. Диаметр хода поршня 88 мм, ход элемента не изменился.

Существуют другие модификации, но они не получили широкого распространения. Среди силовых агрегатов стоит выделить ЗМЗ 5233, 5234 и 513. На моделях ГАЗ они встречаются крайне редко.

Обслуживание

У двигателя ГАЗ 53 неплохой ресурс. Мотор отличается высоким уровнем выносливости. Он обеспечивает длительный срок эксплуатации транспортного средства, практически не подвергается частым поломкам и не выходит из строя.

Чтобы увеличить эксплуатационный ресурс двигателя, следует регулярно проводить техническое обслуживание мотора. Оно включает в себя следующие работы:

  • Регулярную замену моторного масла. Оптимальный показатель для замены — это прохождение транспортным средством свыше 6 тыс. км. В качестве моторного масла специалисты рекомендуют применять минеральный тип состава или полусинтетику. Такие жидкости подходят для УАЗов и Волг.
  • Настройку положения головки блоков, подтяжку крепежных элементов коллектора. Последний известен, как паук. Процедуру рекомендуется выполнять каждые 1-2 тыс. км пробега автомобиля. Если в процессе эксплуатации была заменена прокладка ГБЦ или ремонт другого элемента системы, процедура является обязательной. Стоит учесть, что выполнение подтяжки следует проводить, когда двигатель остынет.
  • Проверять и регулировать уровень жидкости в системе охлаждения. Эта процедура способна перейти в разряд ежедневных. Особенно важно это делать летом, так как повышение температуры способно вызвать перегрев двигателя. Ремонт охлаждающей системы мотора стоит дорого. Поэтому, если не хочется переплачивать за ошибку, следует ответственно отнестись к данному пункту.
  • Регулировать положение клапанов. От того, как установлен клапан, зависит работоспособность мотора и величина компрессии в процессе эксплуатации. Сразу стоит отметить, что газораспределительная система собрана качественно, поэтому каждый день настраивать клапаны не нужно. В основном процедуру рекомендуют проводить после замены прокладок головки блока цилиндров.
  • Контролировать уровень масла, которое находится в емкости внутреннего сгорания. В основном это касается владельцев Волг и УАЗов. Подобная процедура проводится для обеспечения элементов и механизмов необходимым количеством смазывающей жидкости во время эксплуатации транспортного средства. Для отслеживания внутри емкости предусмотрен уровень, который позволит вовремя определить недостаток масла и долить его.
  • Проводить внешний осмотр автомобиля. Дело в том, что во время поездок могут произойти разные поломки, одна из которых способна привести к образованию течи масла из двигателя. Многие утверждают, что это одна из главных проблем двигателя, которая требует решения. Если течь была обнаружена, необходимо как можно быстрее принять меры по ее устранению.

Дополнительно опытные водители и мастера рекомендуют периодически разбирать силовой агрегат, чтобы проверить его работоспособность и состояние. Разборка и сборка осуществляются посредством использования набора ключей. Для проведения работ потребуется опыт, поэтому начинающим водителям лучше обратиться за помощью профессионалов.

Для замены масла потребуется выполнить следующие действия:

  1. Демонтировать крышку горловины емкости и снять ее.
  2. Снять пробку, которая закрывает сливное отверстие.
  3. Дождаться, пока стечет масло. Предварительно рекомендуется подставить под горловое отверстие заранее подготовленную емкость.
  4. Удалить фильтр и заменить его на деталь.
  5. Залить небольшое количество жидкости в полость обновленного фильтра.
  6. Залить моторное масло в емкость силового агрегата.

Далее необходимо запустить мотор и дать ему прогреться. Это поможет ускорить распределение масла по всем механизмам конструкции. Последний шаг заключается в проверке наличия протечек. Если их нет, замену топливной жидкости можно считать успешно завершенной. Если они присутствуют, необходимо устранить протечку и долить масло до нужного уровня.

Возможные неисправности

К распространенным поломкам ГАЗ 53, которые возникают в процессе эксплуатации транспортного средства, относят:

  1. Увеличение расхода топлива. В основном проблема возникает из-за того, что масло начинает вытекать через соединения элементов или сальники.
  2. Стук во время работы шатунного вкладыша. Причиной возникновения поломки является недостаточный уровень масла или износ деталей.
  3. Стук поршня. Главная причина – поломка юбки и перегородки механизма. Также стук может возникнуть из-за того, что прогорело днище.
  4. Прогорание прокладок. Опасная ситуация, сообщающает о том, что произошел перегрев деталей.
  5. Прогорание выпускного клапана. Происходит из-за использования бензина низкого качества.

Любая поломка требует ремонта или замены. Игнорирование ситуации может привести к выходу из строя механизма, системы или двигателя в целом.

Тюнинг

Сегодня грузовики ГАЗ уже не выпускают, а машины этой серии, продолжающие двигаться по дорогам, требуют доработок и модернизации конструкции. Объясняется это тем, что автомобиль уже не выглядит таким, каким был во времена Советского Союза. Поэтому владельцы транспортных средств прибегают к разным видам тюнинга, чтобы вернуть красоту грузовику и улучшить его эксплуатационные характеристики.

Модернизация двигателя

Самый распространенный вариант тюнинга — это улучшение двигателя, который используется в машине. Прежде всего, потребуется полностью поменять старый мотор на агрегат, у которого будет большая часть следующих преимуществ:

  • небольшой расход топлива;
  • длительный срок службы, позволяющий эксплуатировать устройство до 400 тыс. км пробега;
  • простота в обслуживании;
  • высокий КПД.

Установка такого мотора сделает поездку на грузовике более комфортной и быстрой. Если было принято решение менять силовой агрегат, то необходимо выполнить:

  1. Демонтаж предыдущего мотора.
  2. Сварку креплений на раме.
  3. Замену системы выхлопа, емкости топливного бака и проводки.

Также потребуется переделать карданный вал и поменять переходники устройства.

Модернизация кабины

После того, как будет обновлен двигатель, можно приступить к улучшению внутреннего пространства. Стоит отметить, что первоначальный вариант кабины не отличается особым изыском и комфортом. Внутри все выполнено с использованием простого пластика и металла большой толщины. Поэтому водители принимают решение о внесении ряда изменений для организации комфортного передвижения.

Возможные варианты модернизации:

  • прикрепление плафона от иномарки;
  • установка центрального замка;
  • монтаж сигнализации.

Дополнительно выполняют замену обивки сидений, установку современных приборных панелей и других устройств, способных сделать передвижение на транспортном средстве удобным.

Модернизация трансмиссии

Такой вариант тюнинга заслуживает отдельного внимания. Для обновления трансмиссии можно воспользоваться задним мостом от ГАЗ 3307 и установить конструкцию на автомобиль, который подвергается тюнингу. Результатом станет улучшения конструкция подвески, в которой предусмотрена автоматическая блокировка заднего моста.

Примечательно, что некоторые способны превратить классический ГАЗ 53 в настоящий пикап, установив в нем силовой агрегат объемом свыше 5 литров.

ГАЗ 53 (4×2) бортовой автомобиль — фото, характеристики, схема, описание

Модель автомобиля ГАЗ-53-12
Годы выпуска 1983-1993
Грузоподъемность, кг 4500
Наибольшая полная масса прицепа, кг 3500
Собственная масса, кг 3200
Полная масса, кг 7850
Габаритные размеры автомобиля (длина х ширина х высота по кабине без нагрузки), мм 6395 х 2380 х 2220
База 3700
Колея передних колес (на плоскости дороги), мм 1630
Колея задних колес (между серединами двойных скатов), мм 1690
Дорожный просвет автомобиля (под картером заднего моста), мм 265
Радиус поворота по колее наружного переднего колеса, м 8
Наибольшая скорость с полной нагрузкой на горизонтальных участках ровного шоссе, км/ч 90
Торм. путь со скорости 50 км/ч, м 25
Контр, расход топлива при 60 км/ч, л/100 км 19,6
Угол свеса передний (с нагрузкой), град 41
Угол свеса задний (с нагрузкой), град 25
Наибольший угол преодолеваемого автомобилем подъема с полной нагрузкой, проц. 25
Погрузочная высота платформы, мм 1350
Двигатель
Модель ЗМЗ-53-11
Тип 4-тактный, карбюраторный, бензиновый
Число и расположение цилиндров 8, V-образное
Диаметр цилиндра и ход поршня, мм 92 / 80
Рабочий объем, л 4,25
Степень сжатия 7,6
Порядок работы цилиндров 1-5-4-2-6-3-7-8
Макс, мощность, л. с. (кВт) 125 (92) при 3200 об/мин
Макс, крутящий момент, об/мин кгс-м (Н-м) 30 (294) при 2000-2500 об/мин
Направление вращения коленчатого вала правое
Подогрев рабочей смеси жидкостный
Система смазки комбинированная
Охлаждение жидкостное, принудительное, с центробежным насосом. В системе охлаждения имеется термостат
Карбюратор К-135, двухкамерный, балансированный, с падающим потоком
Ограничитель частоты вращения пневмоцентробежного типа
Электрооборудование
Система проводки однопроводная, минус соединен с корпусом
Напряжение в сети электрооборудования, В 12
Генератор Г250-Г2
Регулятор напряжения 22.3702
Аккумуляторная батарея 6СТ-75
Стартер СТ230-А1
Катушка зажигания Б116
Датчик-распределитель 24.3706
Свечи зажигания А11-30
Транзисторный коммутатор 13.3734-01
Добавочный резистор 14.3729
Стеклоочиститель СЛ100
Фара ФГ122БВ или 522.3711
Передние фонари ПФ130
Задние фонари ФП130, ФП130Б
Трансмиссия
Сцепление однодисковое, сухое
Коробка передач трехходовая, 4-ступенчатая
Главная передача коническая, гипоидного типа
Передаточные числа коробки передач 6,55; 3,09; 1,71; 1,0; З.Х. — 7,77
Передаточные числа главной передачи 6,17
Дифференциал конический, шестеренчатый
Полуоси полностью разгруженные
Ходовая часть
Колеса дисковые, с ободом 6,0Б-20 (152Б-508) с разрезным бортовым кольцом
Шины пневматические радиальные размером 8,25R20 (240R508) и диагональные размером 8,25-20 (240-508)
Давление воздуха в шинах, кПа (кгс/см2):
радиальных передних
радиальных задних
диагональных передних
диагональных задних
390 (4,0)
620 (6,3)
280 (2,8)
500 (5,0)
Установка передних колес угол развала колес 1°
угол бокового наклона шкворня 8°
угол наклона нижнего конца шкворня вперед 2°30'
схождение колес 0-3 мм
Рессоры четыре — продольные, полуэллиптические. Задняя подвеска состоит из основных и дополнительных рессор
Амортизаторы гидравлические, телескопические, двухстороннего действия. Установлены на передней оси автомобиля
Рулевое управление
Тип рулевого механизма глобоидный червяк с трехгребневым роликом
Передаточное число 21,3 (среднее)
Рулевые тяги трубчатые, шарниры нерегулируемой конструкции
Тормозное управление
Рабочая тормозная система двухконтурная с гидравлическим приводом и гидровакуумным усилителем в каждом контуре
Тормозные механизмы колодочные, барабанного типа
Запасная тормозная система каждый контур рабочей тормозной системы
Стояночная тормозная система с механическим приводом к тормозному механизму, расположенному на трансмиссии
Кабина и платформа
Кабина металлическая, двухместная, двухдверная
Платформа деревянная с металлическим каркасом. Откидные борта — задний и оба боковых
Размеры платформы внутренние (длина х ширина х высота бортов), мм 3740 х 2170 х 610
Данные для контроля и регулировки
Зазор между коромыслами и клапанами на холодном двигателе (температура 15-20 °C), мм 0,25-0,30
Допускается у крайних клапанов обоих рядов (впускных 1 и 8, выпускных 4 и 5 цилиндров) устанавливать зазор, мм 0,15-0,20
Зазор между электродами свечей, мм 0,85-1,0
Прогиб ремней вентилятора и генератора при нагрузке 4 даН (4 кгс), мм 10-15
Свободный ход педали тормоза, мм 8-14
Свободный ход педали сцепления, мм 35-45
Угол свободного поворота рулевого колеса, град., не более 25
Регулируемое напряжение, В 13,8-14,6

Технические характеристики ГАЗ 53-12

Общие данные

Тип автомобиля - двухосный грузовой автомобиль с приводом на заднюю ось.

Грузоподъемность, кг - 4500.

Наибольшая полная масса прицепа*, кг - 3500.

Полная масса автомобиля, кг - 7850.

Масса автомобиля в снаряженном состоянии, кг - 3200.

Габаритные размеры автомобиля, мм:

  • длина - 6395.
  • ширина - 2380.
  • высота (по кабине без нагрузки) - 2220.

База, мм - 3700.

Колея передних колес (на плоскости дороги), мм - 1630.

Колея задних колес (между серединами двойных скатов), мм - 1690.

Дорожный просвет автомобиля (под картером заднего моста), мм - 265.

Радиус поворота по колее наружного переднего колеса, м - 8.

Наибольшая скорость с полной нагрузкой на горизонтальных участках ровного шоссе, км/ч - 90.

Контрольный расход топлива при замере в летнее время для обкатанного автомобиля, движущегося с полной нагрузкой на четвертой передаче, с постоянной скоростью 60 км/ч по сухой ровной дороге с усовершенствованным покрытием и короткими подъемами, не превышающими 0,5°, л/100 км - 19,6**.

Путь торможения автомобиля с полной нагрузкой, без прицепа, движущегося со скоростью 50 км/ч на горизонтальном участке сухой дороги с усовершенствованным покрытием, при приложении усилия к тормозной педали в 70 даН (70 кгс), м - 25.

Углы свеса (с нагрузкой), град:

  • передний - 41.
  • задний 25.

Наибольший угол преодолеваемого автомобилем подъема с полной нагрузкой, проц. - 25.

Погрузочная высота платформы, мм - 1350.

* Допускается буксирование двухосного прицепа с инерционно-гидравлическим приводом тормозов.

** Приведенный расход топлива не является нормой, а служит лишь для определения технического состояния автомобиля. Расход топлива определен для автомобиля с радиальными шинами.

Двигатель

Тип - 4-тактный, карбюраторный, бензиновый.

Число и расположение цилиндров - 8, V-образное.

Диаметр цилиндров, мм - 92.

Ход поршня, мм - 80.

Рабочий объем, л - 4,25.

Степень сжатия - 7,6.

Номинальная мощность (с ограничителем) при 3200 об/мин., кВт (л. с.) - 92 (125).

Максимальный крутящий момент при 2000-2500 об/мин., даН*м (кгс*м) - 294 (30).

Порядок работы цилиндров - 1-5-4-2-6-3-7-8.

Направление вращения коленчатого вала - Правое.

Подогрев рабочей смеси - Жидкостной.

Система смазки - Комбинированная.

Охлаждение - Жидкостное, принудительное, с центробежным насосом. В системе охлаждения имеется термостат.

Карбюратор - К-135, двухкамерный, балансированный, с падающим потоком.

Ограничитель частоты вращения - Пневмоцентробежного типа.

Трансмиссия

Сцепление - Однодисковое, сухое.

Коробка передач - Трехходовая, 4-ступенчатая.

Передаточные числа - 1 передача - 6,55, 2 передача - 3,09, 3 передача - 1,71, 4 передача - 1,0, задний ход - 7,77.

Карданная передача - Открытого типа. Имеет два вала и три карданных шарнира с игольчатыми подшипниками. Снабжена промежуточной опорой.

Главная передача - Коническая, гипоидного типа. Передаточное число 6,17.

Дифференциал - Конический, шестеренчатый.

Полуоси - Полностью разгруженные.

Ходовая часть

Колеса - Дисковое, с ободом 6,0Б-20 (152Б-508) с разрезным бортовым кольцом.

Шины - Пневматические радиальные размером 8,25R20 (240R508) и диагональные размером 8,25-20 (240-508).

Давление воздуха в шинах, кПа (кгс/см2):

Радиальных:

  • передних колес - 390 (4,0).
  • задних колес - 620 (6,3).

Диагональных:

  • передних колес - 280 (2,8).
  • задних колес - 500 (5,0).

Установка передних колес - Угол развала колес 1°. Угол бокового наклона шкворня 8°. Угол наклона нижнего конца шкворня вперед 2°30'. Схождение колес 0-3 мм.

Рессоры - Четыре - продольные, полуэллиптические. Задняя подвеска состоит из основных и дополнительных рессор.

Амортизаторы - Гидравлические, телескопические, двухстороннего действия. Установлены на передней оси автомобиля.

Рулевое управление

Тип рулевого механизма - Глобоидный червяк с трехгребневым роликом.

Передаточное число - 21,3 (среднее).

Рулевые тяги - Трубчатые, шарниры нерегулируемой конструкции.

Тормозное управление

Рабочая тормозная система - Двухконтурная с гидравлическим приводом и гидровакуумным усилителем в каждом контуре. Тормозные механизмы - колодочные, барабанного типа.

Запасная тормозная система - Каждый контур рабочей тормозной системы.

Стояночная тормозная система - С механическим приводом к тормозному механизму, расположенному на трансмиссии.

Электрооборудование

Система проводки - Однопроводная, минус соединен с корпусом.

Номинальное напряжение в сети, В - 12.

Генератор - Г250-Г2.

Регулятор напряжение - 22.3702.

Аккумуляторная батарея - 6СТ-75.

Стартер - СТ230-А1.

Катушка зажигания - Б116.

Датчик-распределитель - 24.3706.

Свечи зажигания - А11-30.

Транзисторный коммутатор - 13.3734-01.

Добавочный резистор - 14.3729.

Стеклоочиститель - СЛ100.

Фара - ФГ122БВ или 522.3711.

Передние фонари - ПФ130.

Задние фонари - ФП130, ФП130Б.

Кабина и платформа

Кабина - Металлическая, двухместная, двухдверная.

Платформа - Деревянная с металлическим каркасом. Откидные борта - задний и оба боковых.

Размеры платформы внутренние, мм:

  • длина - 3740.
  • ширина - 2170.
  • высота бортов - 610.

Данные для контроля и регулировки

Зазор между коромыслами и клапанами на холодном двигателе (температура 15-20 °C), мм - 0,25-0,30.

Допускается у крайних клапанов обоих рядов (впускных 1 и 8, выпускных 4 и 5 цилиндров) устанавливать зазор, мм - 0,15-0,20.

Зазор между электродами свечей, мм - 0,85-1,0.

Прогиб ремней вентилятора и генератора при нагрузке 4 даН (4 кгс), мм - 10-15.

Свободный ход педали тормоза, мм - 8-14.

Свободный ход педали сцепления, мм - 35-45.

Угол свободного поворота рулевого колеса, град., не более 5*-25.

Регулируемое напряжение, В - 13,8-14,6.

* Для автомобилей в пределах гарантийного периода.

Физические и химические свойства топлива военного назначения - допустимые уровни воздействия для отдельных паров военного топлива

J и другие виды топлива и судовое дизельное топливо (DFM) представляют собой сложные смеси углеводородов, полученные путем перегонки сырой нефти. Они содержат сотни углеводородов, а также множество присадок. Фактический состав любого данного топлива варьируется в зависимости от источника сырой нефти, процессов нефтепереработки и технических характеристик продукта. Углеводороды в реактивном и дизельном топливе менее летучие, чем в бензине.JP-5 - реактивное топливо с высокой температурой воспламенения, разработанное ВМФ. JP-5 представляет собой специально очищенный тип керосина, состоящий из парафинов C9-C16 (53%), циклопарафинов (31%), ароматических углеводородов (16%) и олефинов (0,5%). Содержание ароматических веществ в JP-5 может варьироваться от менее 2,5% до более 22% по объему. Содержание бензола в JP-5 обычно составляет менее 0,02% (Dollarhide, 1992), и в JP-5 может присутствовать небольшое количество полициклических ароматических углеводородов. Поскольку загрязнение воды в авиационном топливе является серьезной проблемой, в топливо добавляется ингибитор обледенения топливной системы, чтобы исключить образование льда в системах самолета.JP-8 аналогичен коммерческому реактивному топливу А-1. JP-8 был разработан для ВВС, чтобы обеспечить безопасное реактивное топливо на основе керосина, которое по-прежнему будет иметь адекватную надежность и приемлемую температуру замерзания. DFM представляет собой смесь дизельного топлива, которая в основном аналогична керосину, в которую были добавлены высококипящие фракции и высококипящие остаточные масла. Дизельное топливо состоит в основном из углеводородов C9-C20. Для DFM это примерно 13% парафинов, 44% ароматических углеводородов и 44% нафталина. DFM может также содержать менее 10% полициклических ароматических углеводородов.

Рассматривая потенциальную токсичность паров топлива, важно отметить, что многие соединения в топливе не присутствуют в парах (Bishop, 1982). В этом отчете рассматривается токсичность более летучих фракций топлива, а не токсичность всего топлива. Ожидается, что состав паров трех рассматриваемых видов топлива будет аналогичным, поскольку топливо производится путем смешивания керосина с различными количествами низкокипящих дистиллятов.

Физические и химические свойства военного топлива JP-5, JP-8 и DFM описаны ниже.

ТОПЛИВО ДЛЯ ДВИГАТЕЛЕЙ 5

Вид в собственном окне

Молекулярный вес: ≈185
Синонимы: Топливо для реактивных двигателей JP-5, MIL-T-5624M, AVCAT
Температура замерзания, максимальная: -46 ° C
Точка кипения: 156-293 ° C
Начальная точка: 182 ° C (156-191 ° C)
10% испарено: 199 ° C (180-211 ° C)
20% испарения: 207 ° C (199-213 ° C)
50% испарения: 220 ° C (212- 229 ° C)
90% испарения: 246 ° C (236-275 ° C)
Конечная точка: 166 ° C (248-293 ° C)
Температура вспышки, минимум: 60 ° C
Давление пара: 0.52 мм рт. Ст. (10 ° C) 1,8 мм рт. Теплотворная способность, БТЕ / фунт, минимум
:
18,300
Температура самовоспламенения: 246 ° C
Вязкость, максимальная при -20 ° C: 8,5
Состав: C 9 –C 16 парафины, об.% ≈ 53%;
циклопарафинов, об.% ≈ 31%;
ароматических углеводородов, об.% ≈ 16%;
олефинов, об.% ≈ 0.5%.
Ароматические углеводороды, типичные для крекинг-бензина и керосина, включают бензол, алкилбензолы, толуол, ксилол, индены, нафталины. Содержание бензола = 0,02%.
Коэффициенты пересчета при стандартной температуре и давлении: 1 ppm = 8,3 мг / м 3
1 мг / м 3 = 0,12 ppm

JET-PROPULSION FUEL 8

Посмотреть в собственном окно

Молекулярный вес: ≈180
Синонимы: Реактивное топливо JP-8, MIL-T-83133B, АВТУР
Температура замерзания максимальная: -47 ° C
Точка кипения: 175-300 ° C
Извлечение 10%, максимум: 205 ° C
Конечная точка, максимальная: 300 ° C
Температура вспышки, минимум : 38 ° C
Давление пара: 0.52 мм рт. Ст. (10 ° C) 1,8 мм рт. Теплотворная способность, БТЕ / фунт, минимум
:
18400
Вязкость, максимальная при -20 ° C: 8
Состав: C 8 –C 9 алифатические углеводороды,
об.% ≈ 9% C 10 –C 14 алифатические
углеводороды, об.% ≈ 65%;
C 15 –C 17 алифатические
углеводороды, об.% ≈ 7%;
ароматических углеводородов, об.% ≈ 18%.
Ароматические углеводороды, типичные для крекинг-бензина и керосина, включают бензол, алкилбензолы, толуол, ксилол, индены, нафталины.
Коэффициенты пересчета при стандартной температуре и давлении: 1 ppm = 8,0 мг / м 3
1 мг / м 3 = 0,12 ppm

DIESEL FUEL MARINE

Вид в собственном окне

Молекулярный вес: 198-202
Синонимы: ДМФА, дизельное топливо, бензин, номер дизельного топлива.4, дистиллят
Температура замерзания, максимальная: NA
Точка кипения, 760 мм рт. Ст .: 220-400 ° C
Извлечение 90%,
Минимум:
282 ° C
Максимум: 338 ° C
Удельный вес, кг / л, 15 ° C: 0,87
Вязкость, 40 ° C: 1,9-4,1
Плотность пара ( воздух = 1): 8
% летучих по объему при 38 ° C: Незначительная
Температура вспышки: 52 ° C
Температура самовоспламенения: 257 ° C
Состав: C 9 –C 20 парафины, об.% ≈ 13%;
ароматических углеводородов, об.% ≈ 44%;
нафталинов, об.% ≈ 44%;
может содержать некоторое количество (<10%) полициклического ароматического углеводорода
.
Коэффициенты пересчета при стандартной температуре и давлении: 1 ppm = 8,9 мг / м 3
1 мг / м 3 = 0,11 ppm

Йод - Информация об элементе, свойства и использование

Расшифровка:

Химия в ее элементе: йод

(Promo)

Вы слушаете Химию в ее элементе, представленную вам Chemistry World , журналом Королевского химического общества.

(Конец промо)

Крис Смит

Здравствуйте, на этой неделе кретины, крекеры и чистая вода. История начинается в Италии, а вот и Андреа Селла.

Андреа Селла

Когда я был ребенком, каждое лето я проводил пару недель высоко в итальянских Альпах в идиллической деревушке под названием Конь, которая тихо уютно устроилась между высокими покрытыми льдом пиками. Для большинства итальянцев это имя ассоциируется с сенсационным убийством.Другие знают, что зимой в долине одни из лучших мест для ледолазания в Альпах. Но для меня Конь всегда будет связан с йодом.

Однажды днем, когда мне было около 10 лет, возвращаясь с отцом из долгой прогулки, мы миновали унылое серое здание на окраине деревни. Он был окружен высоким металлическим забором и выглядел как учреждение. На скамейке в одиночестве сидел странно выглядящий старик - у него были взлохмаченные волосы, пустой взгляд и большой вздутый мешочек кожи на месте шеи.Я был совершенно потрясен этим странным существом. Я приставал к отцу вопросами. Кто был он? Что с ним не так? Почему он выглядел таким грустным?

Мой отец, чье терпение перед шквалом вопросов было почти безграничным, объяснил, что бедняк вырос с недостаточным содержанием йода в рационе. Йод, продолжал он, необходим для правильного развития щитовидной железы в области шеи, и что, если человек не будет есть правильную соль, особенно в детстве, у него может развиться зоб, а также пострадает умственное развитие. .Позже я читал об английских путешественниках, проходящих через Альпы, о Кретинских долинах - путевые книги того периода часто содержат мрачные иллюстрации этих несчастных. Цифры ошеломляют; Наполеоновская перепись населения кантона Вале в 1800 году обнаружила 4000 кретинов при населении 70 000 человек - более чем у 50% был бы зоб.

Болезнь была известна писателям-медикам на протяжении веков. Гален, например, рекомендовал лечение морскими губками. В 1170 году Роджер Салерно рекомендовал морские водоросли.Аналогичные предложения были сделаны и в Китае.

Парацельс, великий целитель, алхимик и писатель эпохи Возрождения, был одним из первых, кто заметил связь между зобом и кретинизмом, и первым предположил, что минералы в питьевой воде могут играть роль в возникновении этого состояния. Но что это за загадочные минералы, оставалось загадкой.

В 1811 году молодой французский химик Бернар Куртуа, работая в Париже, наткнулся на новый элемент. Фирма его семьи производила селитру, необходимую для производства пороха для наполеоновских войн.Для этого использовали древесную золу. Нехватка древесины во время войны вынудила их вместо этого сжигать водоросли, которых было много на побережье северной Франции. Добавив к золе концентрированную серную кислоту, Куртуа получил удивительно пурпурный пар, который кристаллизовался на стенках контейнера. Пораженный этим открытием, он запаковал кристаллы в бутылки и отправил их одному из ведущих химиков своего времени Жозефу Гей-Люссаку, который подтвердил, что это новый элемент, и назвал его иодом - йод - в честь греческого слова, обозначающего пурпурный.Куртуа продолжал играть с элементом и был довольно шокирован, обнаружив, что при смешивании с аммиаком он дает твердое вещество шоколадного цвета, которое взрывается при малейшей провокации. Его современнику, Пьеру Дюлонгу, повезло меньше: он потерял глаз и часть руки при изучении материала, став первым в длинном списке жертв из-за этого неприятного материала.

Ядовитые свойства йода вскоре были осознаны, и настойка в виде желтовато-коричневого раствора стала широко использоваться в качестве дезинфицирующего средства.Даже сегодня самые распространенные таблетки для очистки воды, которые можно купить в туристических магазинах, основаны на йоде.

Спустя всего два года после его открытия врач в Женеве Франсуа Коиндэ начал задаваться вопросом, не является ли йод в водорослях отсутствующим минералом, ответственным за зоб. Поэтому он начал назначать своим пациентам настойку йода перорально, что было неприятным делом, но, по его словам, это привело к исчезновению опухоли через 6-10 недель. Однако его коллеги обвинили его в том, что он отравил своих пациентов, и в какой-то момент он, как говорили, не мог выходить на улицу из-за страха подвергнуться нападению.

Но, хотя элементарный йод явно был токсичен на , Коиндет был на правильном пути, и в течение 19, -го, века, сделав один шаг вперед на два шага назад, гипотеза постепенно завоевала доверие по мере экспериментов с более вкусной солью. , йодид калия, показали, что зоб можно вылечить. К началу 1920-х годов швейцарские кантоны начали вводить йодированную соль, и в последующие десятилетия многие страны, страдающие от зоба, последовали их примеру, и эта политика была настолько эффективной, что многие из нас в развитом мире не знали, насколько серьезной была эта болезнь, и слово кретин во многом потеряло свое значение.

Когда я вернулся в Конь прошлым летом, я попытался вспомнить, где был институт. Все, что я смог найти, это летний лагерь для отдыха, где дети весело играли за воротами, где я видел старика. Я позвонил своему отцу, чтобы спросить его, и мы поговорили о былых временах - плохих старых временах кретинов - и о призраках, изгнанных этим уникальным пурпурным элементом - йодом.

Крис Смит

Призраки, которые явно живут среди британской аристократии. Это химик из Калифорнийского университета в Лос-Анджелесе Андреа Селла рассказывал историю о йоде, элементе номер 53.На следующей неделе мы направим внимание на вещество, которое вообще не нуждается в освещении, потому что оно излучает собственный свет.

Brian Clegg

Его считали источником энергии и яркости, его использовали в зубных пастах и ​​патентованных лекарствах - его даже втирали в кожу головы как средство для восстановления волос.

Но применение радия, которое принесло ему известность, заключалось в его использовании в светящейся в темноте краске. Жуткое синее свечение радия, часто используемое для обеспечения световых индикаторов на часах и часах, переключателях самолетов и циферблатах приборов, рассматривалось как безвредный и практичный источник ночного освещения.И только когда несколько рабочих, которые красили светящиеся циферблаты, начали страдать от язв, анемии и рака вокруг рта, стало ясно, что что-то не так.

Крис Смит

И вы можете услышать историю радия от Брайана Клегга на следующей неделе в «Химии в его элементе». Надеюсь, вы присоединитесь к нам. Я Крис Смит, спасибо за внимание и до свидания.

(промо)

(конец промо)

Произошла ошибка при настройке пользовательского файла cookie

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.


Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.


Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в cookie-файлах может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Характеристика коллектора - обзор

Сложная архитектура, характеристики коллектора, распределение воды и газа, схемы накопления-фильтрации и механизмы потока жидкости в коллекторах вулканического газа сильно отличают их от традиционных осадочных коллекторов по характеристикам разработки.

(1)

Производительность сильно различается для скважин, нацеленных на разные резервуары или разные части резервуара, поскольку вулканические резервуары имеют разную литологию, переменную литофациальную структуру, различные физические свойства и сильную неоднородность. По физическим свойствам вулканические коллекторы можно разделить на четыре типа: высокопористые и высокопроницаемые коллекторы, коллекторы средней и средней проницаемости, коллекторы с низкой и низкой проницаемостью и плотные коллекторы.Вулканические резервуары были обнаружены в различных вулканических породах, таких как лава, вулканокластические породы и обломочные лавы. Для пластов с хорошими физическими свойствами высокая естественная продуктивность может быть достигнута обычными методами. Для пластов с плохими физическими свойствами естественная продуктивность низкая, поэтому для получения промышленного потока газа необходим гидроразрыв пласта. Для плотных коллекторов вулканического газа естественная продуктивность практически равна нулю, и требуется объемный гидроразрыв пласта, чтобы получить промышленную добычу из скважин.Например, в Блоке XX21 газового месторождения XX, Дацин, скважины имеют начальную стабильную суточную добычу от 20 × 10 4 м 3 по природной энергии до менее 1 × 10 4 м 3 после гидравлического ГРП, а также соседние скважины с расстоянием между скважинами менее 500 м могут иметь начальные стабильные дебиты, отличающиеся друг от друга более чем в пять раз. Очевидно, что скважины в разных коллекторах вулканического газа или в одном пласте вулканического газа могут иметь большие расхождения в производительности.

(2)

Производство быстро снижается, и стабильное производство трудно поддерживать. Существует несколько типов вулканических коллекторов, включая пористые, трещиноватые, трещиновато-пористые и пористо-трещиноватые, с различными механизмами потока жидкости и производительностью. Для трещиноватых и пористо-трещиноватых коллекторов газ в основном подается через систему трещин; Изначально добыча из скважины высока, но затем быстро снижается из-за быстрого истощения энергии, ограниченного газоснабжения системы трещин и недостаточной подачи газа из матрицы в систему трещин.В трещиновато-пористых коллекторах газ в основном подается через систему трещин и макропоры, что приводит к относительно более высокой начальной добыче газа; однако впоследствии добыча газа резко снижается из-за быстрого истощения энергии системы трещин и макропор и недостаточной подачи газа из матрицы и микропор в систему трещин. В пористых коллекторах газ в основном подается через систему пор; добыча скважин относительно стабильна, но она подвержена сильной неоднородности и плохой связи и непрерывности вулканических резервуаров.В соответствии с фактическими производственными показателями, залежи вулканического газа обычно имеют общий годовой темп снижения от 30% и более до 80%. Очевидно, что коллекторы вулканического газа характеризуются быстрым падением добычи и трудностями в поддержании стабильной добычи в целом.

(3)

Контролируемые запасы и накопленная добыча газа сильно различаются по скважинам. Хорошо контролируемые запасы и максимальная накопленная добыча газа из скважин зависят от пропускной способности хранилища, масштабов и внутренней связности резервуаров.Вулканические резервуары имеют плохую соединяемость и большие различия по форме, масштабу и фильтрационной способности накопителей, что приводит к значительным различиям в хорошо контролируемых запасах с широким диапазоном от 0,001 × 10 8 м 3 до 20 × 10 8 м 3 . Согласно статистике разрабатываемых залежей вулканического газа в Китае, эффективно разрабатываемые залежи вулканического газа имеют большие вертикальные хорошо контролируемые запасы, составляющие 4–6 × 10 8 м 3 или даже более 10 × 10 8 м 3 , но этот тип резервуара вулканического газа составляет только около 20%; неэффективно разработанные залежи вулканического газа, как правило, имеют небольшие вертикальные хорошо контролируемые запасы, составляющие около 1-2 × 10 8 м 3 , и этот вид залежей вулканического газа составляет около 30%; Плотные резервуары вулканического газа имеют самые низкие вертикальные хорошо контролируемые запасы, составляющие менее 1 × 10 8 м 3 , и этот тип резервуаров вулканического газа является преобладающим, около 50%.Большие различия в хорошо контролируемых запасах и сильная неоднородность коллектора приводят к широкому диапазону накопленной добычи газа - от 0,001 × 10 8 м 3 до 10 × 10 8 м 3 на скважину. Более 50% скважин демонстрируют накопленную добычу газа менее 0,5 × 10 8 м 3 на скважину.

(4)

Слои газа и воды соединены трещинами, а вулканические резервуары легко затопляются несколькими типами воды.Вода в резервуарах вулканического газа существует в различных формах, таких как вода у кромки / дна, межслоевая подвижная вода, внутрислойная невосстанавливаемая вода и конденсированная вода в газовом слое. Слои газа и воды сообщаются прямым контактом, косвенным контактом, трещинами или другими способами. Более того, хорошо развитая система трещин является одной из ключевых характеристик коллекторов вулканического газа, а системы сети трещин, состоящие из естественных трещин и искусственных трещин, могут служить путями для отвода воды от края к дну.Поэтому прорыв воды и конус воды часто возникают в газовых скважинах в коллекторах вулканического газа, что приводит к добыче воды.

NWS JetStream - Слои атмосферы

Газовая оболочка, окружающая Землю, изменяется снизу вверх. Пять отдельных слоев были идентифицированы с использованием ...

  • тепловые характеристики (перепады температур),
  • химический состав,
  • и
  • плотность.

Каждый из слоев ограничен «паузами», где происходят наибольшие изменения тепловых характеристик, химического состава, движения и плотности.

Пять основных слоев атмосферы

Экзосфера

Это самый внешний слой атмосферы. Она простирается от верха термосферы до 6 200 миль (10 000 км ) над Землей. В этом слое атомы и молекулы уходят в космос, а спутники вращаются вокруг Земли. Внизу экзосферы находится термопауза, расположенная на высоте около 375 миль (600 км) над землей.

Между примерно 53 милями (85 км) и 375 милями (600 км) находится термосфера. Этот слой известен как верхняя атмосфера. Хотя газы термосферы все еще очень тонкие, они становятся все более плотными по мере того, как человек спускается к Земле.

Таким образом, поступающее высокоэнергетическое ультрафиолетовое и рентгеновское излучение от солнца начинает поглощаться молекулами в этом слое и вызывает значительное повышение температуры.

Из-за этого поглощения температура увеличивается с высотой.Начиная с -184 ° F (-120 ° C ) в нижней части этого слоя, температура может достигать 3600 ° F (2000 ° C) в верхней части.

Однако, несмотря на высокую температуру, этот слой атмосферы все равно будет очень холодным для нашей кожи из-за очень тонкой атмосферы. Высокая температура указывает на количество энергии, поглощаемой молекулами, но при таком небольшом количестве в этом слое общего количества молекул недостаточно, чтобы нагреть нашу кожу.

Поднимите его до МАКСИМАЛЬНОГО! Ионосфера

Мезосфера

Этот слой простирается от примерно 31 мили (50 км) над поверхностью Земли до 53 миль (85 км).При спуске газы, включая молекулы кислорода, продолжают уплотняться. Таким образом, при спуске температура повышается до примерно 5 ° F (-15 ° C) в нижней части этого слоя.

Газы в мезосфере теперь достаточно толстые, чтобы замедлять метеоры, летящие в атмосферу, где они сгорают, оставляя огненные следы в ночном небе. И стратосфера (следующий слой ниже), и мезосфера считаются средней атмосферой. Переходная граница, отделяющая мезосферу от стратосферы, называется стратопаузой.

Стратосфера

Стратосфера простирается примерно на 31 милю (50 км) вниз до любой точки на высоте от 4 до 12 миль (от 6 до 20 км) над поверхностью Земли. Этот слой содержит 19 процентов атмосферных газов, но очень мало водяного пара.

В этой области температура увеличивается с высотой. В процессе образования озона вырабатывается тепло, и это тепло отвечает за повышение температуры от среднего значения -60 ° F (-51 ° C) в тропопаузе до максимального значения примерно 5 ° F (-15 ° C) в условиях тропопаузы. вершина стратосферы.

Это повышение температуры с высотой означает, что более теплый воздух располагается над более холодным. Это предотвращает «конвекцию», поскольку нет вертикального движения газов вверх. Таким образом, расположение нижней части этого слоя легко увидеть по вершинам кучево-дождевых облаков в форме наковальни.

Тропосфера

Известный как нижняя атмосфера, в этом регионе бывает почти любая погода. Тропосфера начинается на поверхности Земли и простирается от 4 до 12 миль (от 6 до 20 км) в высоту.

Высота тропосферы варьируется от экватора до полюсов. На экваторе он составляет около 11-12 миль (18-20 км) в высоту, на 50 ° N и 50 ° S , 5½ миль, а на полюсах - чуть меньше четырех миль.

Поскольку плотность газов в этом слое уменьшается с высотой, воздух становится тоньше. Следовательно, температура в тропосфере также понижается с высотой в ответ. По мере того, как человек поднимается выше, температура в тропопаузе падает со средней примерно 62 ° F (17 ° C) до -60 ° F (-51 ° C).

Профиль средней температуры для нижних слоев атмосферы

GRI-Mech 3.0

ИЗМЕРЕНИЕ ЗАДЕРЖКИ ЗАЖИГАНИЯ АМОРТИЗАТОРА
IG.1a Сири, Д.Дж., и Боуман, К.Т. (1970) Сжигание. Пламя 14 , 37.

Ч5-О2-Ар
phi = 1,0, P = 1,8, 2,04 атм, T = 1500,1700 K

IG.1b
IG.2 Сири, Д.Дж., и Боуман, К.Т. (1970) Сжигание. Пламя 14 , 37.

Ч5-О2-Ар
phi = 5,01, P = 3,8 атм, T = 1600 К

IG.6a Хидака, Ю., Гардинер, В.С., и Юбанк, К.С. (1982) J. of Molec.Sci. (Китай) 2 , с.141-53.

C2H6-O2-Ar
фи = 0,275 - 0,764, P = 0,25 атм, T = 1600 К

IG.6b
IG.T1 Френклах М. и Борнсайд Д.Э. (1984) Сжигание.Пламя 56 , 1

Ch5-C3H8-O2-Ar (9,5% -1,9% -19% -69,6%)
phi = 1,5, P = 2,5 атм, T = 1410 K

IG.T2 Spadaccini, L.J., и Colket, M.B., (1994) Prog. Энергия Гореть. Sci. 20 , 431.

Ch5-C3H8-O2-Ar (3,4% -0,1% -7% -89,5%)
phi = 1,043, P = 7,095 атм, T = 1640 К

ИГ.Ст1а Spadaccini, L.J., и Colket, MB, (1994) Прог. Энергия сгорания.Sci. 20 , 431.

Ch5-C2H6-O2-Ar (3,29% -0,21% -7% -89,5%)
phi = 1,045, P = 6,1 - 7,6 атм, T = 1356 - 1688 K

ИГ.Ст1б
ИГ.Ст3а Сири, Д.Дж., и Боуман, К.Т., (1970) Сжигание. Пламя 14 , 37.

Ch5-O2-Ar (4,8% -19,1% -76,1%)
phi = 0,5, P = 1,6 - 1,9 атм, T = 1530 - 1845 K

ИГ.Ст3б
ИГ.Ст4а Петерсон, Э.Л., Дэвидсон, Д. Ф., Рориг, М., Хэнсон, Р.К., Боуман, К.Т. (1995), будет опубликовано.

Ch5-O2-Ar, phi = 1,0
P = 34,6 - 83,9 атм, T = 1408 - 1706 K

ИГ.Ст4б
ИЗМЕРЕНИЯ ПРОФИЛЯ УДАРНЫХ ТРУБ
Ch4.C1a Максимальная концентрация Ch4 Чанг, А.Ю., Дэвидсон, Д.Ф., ДиРоза, М., Хэнсон, Р.К., и Bowman, C.T. (1994) 25-й (Международный) симпозиум по горению , Плакат 3 - 23.

Ch5-O2-Ar (994 ppm-0,2021% -99,7%)
phi = 0,984, P = 1,0 атм, T = 2000,2400 K

Канал 4.C1b
Ч4.Т1а Максимальное время канала 4
Ч4.Т1б
шасси 4.C2 Максимальная концентрация Ch4 Чанг, А.Ю., Дэвидсон, Д.Ф., ДиРоза, М., Хэнсон, Р.К., и Bowman, C.T. (1994) 25-й (Международный) симпозиум по горению , Плакат 3 - 23.

C2H6-O2-Ar (295 частей на миллион -0.1055% -99,865%)
phi = 0,769, P = 1,17 атм, T = 1794 K

Ч4.Т2 Максимальное время канала 4
шасси 4.C3 Максимальная концентрация Ch4 Дэвидсон, Д.Ф., ДиРоза, М., Чанг, А.Ю., Хэнсон, Р.К., и Bowman, C.T. (1992) 24-й (Международный) симпозиум по горению , п. 589.

C2H6-Ar (206 частей на миллион)
P = 1,35 атм, T = 1684 К

Ч4.Т3 Максимальное время канала 4
Ч4.C4 Максимальная концентрация Ch4 Чанг, А.Ю., Дэвидсон, Д.Ф., ДиРоза, М., Хэнсон, Р.К., и Bowman, C.T. (1994) 25-й (Международный) симпозиум по горению , Плакат 3 - 23.

Ch5-O2-Ar (0,2021% -0,1% -99,7%)
фи = 4,02, P = 1,02 атм, T = 2264 К

Ч4.Т4 Максимальное время канала 4
шасси 4.StC6 Максимальное время канала 4 Чанг, А.Ю., Дэвидсон, Д.Ф., ДиРоза, М., Хэнсон, Р.К., и Bowman, C.T. (1994) 25-й (Международный) симпозиум по горению , Плакат 3 - 23.

Ch5-O2-Ar (0,1% -0,4% -99,5%)
phi = 0,5, P = 1 атм, T = 1932 - 2454 K

Ch4.StC7
ОН.1а Время до половины максимального значения ОН Чанг, А.Ю., Дэвидсон, Д.Ф., ДиРоза, М., Хэнсон, Р.К., и Bowman, C.T. (1994) 25-й (Международный) симпозиум по горению , Плакат 3 - 23.

Ch5-O2-Ar (0.1% -0,2% -99,7%)
фи = 1, P = 1,0 атм, T = 2000-2200 К

OH.1b
ОН.2 Chang, A.Y., Davidson, D.F., DiRosa, M., Hanson, R.K., and Bowman, C.T. (1994) 25-й симпозиум (международный) по горению , плакат 3 - 23.

C2H6-O2-Ar (300 частей на миллион -0,105% -99,89%)
phi = 0,079, P = 1,21 атм, T = 1817 K

ОН. 3а Время до половины максимального значения ОН Ю., С.Л., Ван, К. и Френклах, М. (1995) J.Phys.Chem. 99 , 14377.

Ч5-О2-Ар, фи = 0,04, P = 1,51 атм, Т = 1750 К

CO.C1a Максимальная концентрация CO
CO.T1a Время до половины максимального значения CO
OH.3b Время до половины максимального значения ОН Yu, C.L., Wang, C., and Frenklach, M. (1995) J.Phys.Chem. 99 , 14377.

Ч5-О2-Ар, фи = 0.04, P = 1,64 атм, Т = 1900 К

CO.C1b Максимальная концентрация CO
CO.T1b Время до половины максимального значения CO
ОН. 3c Время до половины максимального значения ОН Yu, C.L., Wang, C., and Frenklach, M. (1995) J.Phys.Chem. 99 , 14377.

Ч5-О2-Ар, phi = 0,667, P = 1,51 атм, Т = 1750 К

CO.C1c Максимальная концентрация CO
КО.T1c Время до половины максимального значения CO
ОН. 3d Время до половины максимального значения ОН Yu, C.L., Wang, C., and Frenklach, M. (1995) J.Phys.Chem. 99 , 14377.

Ч5-О2-Ар, phi = 0,667, P = 1,64 атм, Т = 1900 К

CO.C1d Максимальная концентрация CO
CO.T1d Время до половины максимального значения CO
OH.ST8 Время до половины максимального значения ОН Ю., С.Л., Ван, К., и Френклах, М., «Химическая кинетика окисления метила молекулярным кислородом». (1995) J.Phys.Chem. 99 , 14377.

Ch5-O2-Ar (1% -1,5% -97,5%)
phi = 1,33, P = 2,45 атм, T = 1865 K

CO.ST8 Время до половины максимального значения CO
CO.SC8 Максимальная концентрация CO
BCO.T1 Время до половины максимального значения CO Eiteneer, B.Ю., К.-Л., Гольденберг, М., Френклах, М., J. Phys. Chem. 102 , 5196, (1998).

Ch3O-Ar P = 1,17 атм, T = 2124 К

BCO.T2 Эйтенир, Б., Ю, К.-Л., Гольденберг, М., и Френклах, М., J. Phys. Chem. 102 , 5196, (1998).

Ch3O-Ar P = 1,51 атм, T = 1724 К

BCO.T3 Эйтенир, Б., Ю, К.-Л., Гольденберг, М., и Френклах, М., Дж.Phys. Chem. 102 , 5196, (1998).

Ch3O-O2-Ar, phi = 5,88 P = 2,32 атм, T = 1784 К

BCO.T4 Эйтенир, Б., Ю, К.-Л., Гольденберг, М., и Френклах, М., J. Phys. Chem. 102 , 5196, (1998).

Ch3O-O2-Ar, фи = 0,25 P = 1,89 атм, T = 1442 К

BCO.T5 Эйтенир, Б., Ю, К.-Л., Гольденберг, М., и Френклах, М., J. Phys. Chem. 102 , 5196, (1998).

Ch3O-O2-Ar, фи = 1,68 P = 0,911 атм, T = 1768

BCO.T6 Эйтенир, Б., Ю, К.-Л., Гольденберг, М., и Френклах, М., J. Phys. Chem. 102 , 5196, (1998).

Ch3O-O2-Ar, phi = 0,17 P = 2 атм, T = 1515 К

BCO.T7 Эйтенир, Б., Ю, К.-Л., Гольденберг, М., и Френклах, М., J. Phys. Chem. 102 , 5196, (1998).

Ch3O-O2-Ar, phi = 1 Р = 1.51 атм, Т = 1720 К

БЧ3О.Т1 Время до половины максимального значения CO Хидака, Ю., Танигути, Т., Танака, Х., Камесава, Т., Инами, К. и Кавано Х. (1993) Combust. Пламя 92 , 365.

Ch3O-O2-Ar, phi = 2,0 - 4,0
P = 1,55 - 2,31 атм, T = 1256 - 1591 К

БЧ3О.Т2
БЧ3О.Т3
РЕАКТОРЫ
SR.10c Температура, где [CO2] = 500 частей на миллион Кристенсен, П.Г., Гларборг, П., Дам-Йохансен, К. (1995), неопубликовано. данные.
ЛАМИНАР СКОРОСТЬ ПЛАМЕНИ
F1 Вагелопулос, С.Н., Эгольфопулос, Ф.Н., «Прямые эксперименты. Определение скорости ламинарного пламени, 'Paper WSS / CI 97S-022, Western States Секция / Заседание Института горения, Ливермор, Калифорния, апрель 1997 г.

Ч5-воздух, T (0) = 300 К
phi = 0,98, P = 1 атм

F2 Вагелопулос, К.М., Эгольфопулос, Ф.Н., и Лоу, К.К., Дальнейшие соображения по определению ламинарного пламени. Скорости с методом противоточного двойного пламени », (1994) 25-й симпозиум (International) по сжиганию , стр. 1341.

Ч5-воздух, T (0) = 300 К
phi = 1,43 - 0,67, P = 1 атм

F3
F4 Эгольфополус, Ф.Н., Чо, П., и Ло, К.К., 'Ламинарное пламя Скорости смесей метан-воздух при пониженном и повышенном давлениях '' (1989). Сжигание.Пламя 76 , 375.

Ч5-воздух, T (0) = 300 К
phi = 1.0, P = 3 атм

F5 Just, Th. (1994) Частное общение.

Ч5-воздух, Т (0) = 400 К
phi = 1.0, P = 4.9 - 19.7 атм

F6
SF7 Маклин, И.С., Смит, Д.Б., и Тейлор, С.Б., (1994) 25-я Симпозиум (Международный) по горению , стр. 749.

CO-h3-воздух, (20,8%, 20,8%, 58.4%) T (0) = 300 К
phi = 1,69, P = 1,0 атм

StF8 Ссылки: Vagelopoulos, C.N., and Egolfopoulos, F.N., «Прямое экспериментальное определение скорости ламинарного пламени», Бумага WSS / CI. 97S-022, Секция западных штатов / Совещание Института горения, Ливермор, Калифорния, апрель 1997 г.

C2H6-воздух, T (0) = 300 К
phi = 1.0, P = 1.0 атм

ПОДСКАЗКА №
SNO.C11 NO (2 см) концентрация Луке, Дж., Смит, Г.П., Кросли, Д. (1996) 26-й симпозиум (Международный) по сжиганию , 959.

Ch5-O2-N2 (13,8% -25,9% -60,3%)
phi = 1,07, P = 0,033 атм

SCH.C11 Максимальная концентрация CH Люк, Дж., Смит, Г.П., Кросли, Д.Р. (1996) 26-й симпозиум (Международный) по сжиганию , 959

Ch5-O2-N2 (13,8% -25,9% -60,3%)
phi = 1,07, P = 0,033 атм

СЧ.C12 Максимальная концентрация CH Берг, П.А., Хилл, Д.А., Ноубл, А.Р., Смит, Г.П., Джеффрис, Дж. Б., Кросли Д. Р. Измерения абсолютной концентрации CH при низких Пламя углеводородов под давлением: сравнение с модельными прогнозами '' (1997) 35-е совещание по аэрокосмическим наукам , Paper 97-0905, Reno.

Ч5-О2-Н2
фи = 0,8 - 1,27, P = 0,033 - 0,0395 атм

SCH.C13
CH.St Максимум концентрации CH без допинга Войки, Д., Вотцмайер, М., Дэвидсон, Д.Ф., Хэнсон, Р.К., и Боуман, C.T., 'Измерения концентрации CH-радикалов в богатых топливом Ch5 / O2 / Ar и Смеси Ch5 / O2 / NO / Ar за ударными волнами », (1998) Сжигание. Пламя 113 , 624.

Ч5-О2-Ар
phi = 1,6, P = 1,8 атм, T = 2800 K

ОКИСЛЕНИЕ HCN
НФР1 Относительная концентрация HCN Проточный реактор: Glarborg, P., and Miller, J.A. (1994) Сжигание. Пламя 99 , 475.

HCN-CO-O2-h3O-N2
(318 частей на миллион-1710 частей на миллион-2,4% -2,8% -94,6%)
P = 798 торр, T = 1165K, время пребывания = 54 мс

NFR2 Относительная концентрация NO
NFR3 Относительная концентрация N2O
NF6 Максимальная мольная доля NO Sandia Flame: Miller, J.A., et al. (1984) 20-й симпозиум (International) по сжиганию , стр. 673.

ч3-O2-HCN-Ar
фи = 1.5, P = 25 торр

NF7 Максимальная мольная доля CN
ПОВТОРНОЕ ГОРЕНИЕ
NF11 Соотношение максимальных концентраций CH при двух уровнях допирования NO NRL Пламя: Уильямс, Б.А., и Флеминг, Дж. У. (1994) Сжигание. Пламя 98 , 93.

Ch5-O2-Ar-NO или N2O (1,2%)
phi = 1,0, P = 10 торр

NF12 / 13 Отношение максимальных концентраций CN для легирования NO и N2O
NFR4 Мольная доля NO на выходе из реактора Проточный реактор: Альзуэта, М.У., Гларборг П. и Дам-Йохансен, К., «Низкотемпературные взаимодействия между углеводородами и оксидом азота. Экспериментальное исследование, Combust. Пламя 109 , 25.

Ch5-C2H6-O2-NO-h3O-N2 (2864 частей на миллион - 298 частей на миллион - 5090 частей на миллион - 947 частей на миллион - 2,16% - 96,92%)
phi = 1,33, P = 1,05 бар, T = 1323 K, время пребывания = 207 мс

NFR5 Мольная доля HCN на выходе из реактора
CHNO.St Максимум концентрации CH без допирования NO Войки, Д., Вотцмайер, М., Дэвидсон, Д.Ф., Хэнсон, Р.К., и Боуман, C.T., 'Измерения концентрации CH-радикалов в богатых топливом Ch5 / O2 / Ar и Смеси Ch5 / O2 / NO / Ar за ударными волнами », (1998) Сжигание. Пламя 113 , 624.

Ч5-О2-NO-Ar
phi = 1,6, P = 1,8 атм, T = 2800 K

Клинические характеристики 138 госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 г., в Ухане, Китай | Реанимационная медицина | JAMA

Ключевые моменты

Вопрос Каковы клинические характеристики госпитализированных пациентов с пневмонией, инфицированной новым коронавирусом 2019 (2019-nCoV) (NCIP), в Ухане, Китай?

Выводы В этой одноцентровой серии случаев с участием 138 пациентов с NCIP 26% пациентов требовали госпитализации в отделение интенсивной терапии и 4 пациента.3% умерли. Предполагаемая передача 2019-nCoV от человека человеку в больнице подозревалась у 41% пациентов.

Значение В этой серии случаев в Ухане, Китай, NCIP часто ассоциировался с предполагаемой передачей в больнице, 26% пациентов нуждались в лечении в отделении интенсивной терапии, а смертность составила 4,3%.

Важность В декабре 2019 года в Ухане, Китай, произошла пневмония, инфицированная новым коронавирусом (2019-nCoV).Число случаев быстро увеличивалось, но информация о клинических характеристиках больных ограничена.

Объектив Описать эпидемиологические и клинические характеристики NCIP.

Дизайн, обстановка и участники Ретроспективная одноцентровая серия случаев 138 последовательных госпитализированных пациентов с подтвержденным NCIP в больнице Чжуннань Уханьского университета в Ухане, Китай, с 1 по 28 января 2020 г .; окончательная дата наблюдения - 3 февраля 2020 г.

Открытия Документировано NCIP.

Основные результаты и мероприятия Были собраны и проанализированы эпидемиологические, демографические, клинические, лабораторные, радиологические и лечебные данные. Сравнивались исходы пациентов в критическом и некритическом состоянии. Предполагаемая передача инфекции в больнице подозревалась в том случае, если заразилась группа медицинских работников или госпитализированных пациентов в одних и тех же палатах, и можно было отследить возможный источник инфекции.

Результаты Из 138 госпитализированных пациентов с NCIP средний возраст составлял 56 лет (межквартильный размах, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Связанная с больницей передача подозревалась как предполагаемый механизм инфекции для затронутых медицинских работников (40 [29%]) и госпитализированных пациентов (17 [12,3%]). Общие симптомы включали лихорадку (136 [98,6%]), усталость (96 [69,6%]) и сухой кашель (82 [59,4%]). Лимфопения (количество лимфоцитов, 0,8 × 10 9 / л [межквартильный размах {IQR}, 0.6-1.1]) наблюдалось у 97 пациентов (70,3%), увеличенное протромбиновое время (13,0 секунды [IQR, 12,3-13,7]) - у 80 пациентов (58%) и повышенное содержание лактатдегидрогеназы (261 Ед / л [IQR, 182- 403]) у 55 пациентов (39,9%). Компьютерная томография грудной клетки показала двусторонние пятнистые тени или матовое стекло в легких у всех пациентов. Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%], цефтриаксон, 34 [24,6%], азитромицин, 25 [18.1%]) и глюкокортикоидной терапии (62 [44,9%]). Тридцать шесть пациентов (26,1%) были переведены в отделение интенсивной терапии (ОИТ) из-за осложнений, включая синдром острого респираторного дистресс-синдрома (22 [61,1%]), аритмию (16 [44,4%]) и шок (11 [30,6%]). %]). Среднее время от появления первых симптомов до одышки составляло 5,0 дней, до госпитализации - 7,0 дней и до ОРДС - 8,0 дней. Пациенты, проходившие лечение в отделении интенсивной терапии (n = 36), по сравнению с пациентами, не проходившими лечение в отделении интенсивной терапии (n = 102), были старше (средний возраст 66 лет против 51 года), с большей вероятностью имели сопутствующие заболевания (26 [72.2%] против 38 [37,3%]), и у них чаще была одышка (23 [63,9%] против 20 [19,6%]) и анорексия (24 [66,7%] против 31 [30,4%]). Из 36 пациентов в отделении интенсивной терапии 4 (11,1%) получали высокопоточную кислородную терапию, 15 (41,7%) получали неинвазивную вентиляцию и 17 (47,2%) получали инвазивную вентиляцию (4 были переведены на экстракорпоральную мембранную оксигенацию). По состоянию на 3 февраля 47 пациентов (34,1%) были выписаны и 6 умерли (общая летальность 4,3%), но остальные пациенты все еще госпитализированы. Среди выписанных живыми (n = 47) средняя продолжительность пребывания в больнице составила 10 дней (IQR, 7.0-14,0).

Выводы и значимость В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%.

Quiz Ref ID В декабре 2019 года в Ухане, провинция Хубэй, Китай, произошел кластер острых респираторных заболеваний, ныне известных как пневмония, инфицированная новым коронавирусом (NCIP). 1 -5 Болезнь быстро распространилась из Ухани в другие районы. По состоянию на 31 января 2020 года в Китае подтверждено 9692 случая заболевания NCIP. На международном уровне случаи заболевания зарегистрированы в 24 странах и 5 континентах. 6 3 января 2020 года новый коронавирус 2019 года (2019-nCoV) был идентифицирован в образцах жидкости бронхоальвеолярного лаважа от пациента из Ухани и был подтвержден как причина NCIP. 7 Полногеномное секвенирование и филогенетический анализ показали, что 2019-nCoV отличается от бета-коронавирусов, связанных с тяжелым острым респираторным синдромом (SARS) и ближневосточным респираторным синдромом (MERS) у человека. 7 2019-nCoV имеет черты, типичные для семейства коронавирусов, и был отнесен к линии бета-коронавируса 2b. 2019-nCoV очень похож на коронавирусы летучих мышей, и было высказано предположение, что летучие мыши являются основным источником. Хотя происхождение 2019-nCoV все еще исследуется, имеющиеся данные свидетельствуют о том, что его распространение среди людей произошло через передачу от диких животных, незаконно продаваемых на оптовом рынке морепродуктов Хуанани. 8

Хуанг и др. 9 впервые сообщили о 41 случае NCIP, в котором большинство пациентов в анамнезе контактировали с оптовым рынком морепродуктов Хуанань.Клинические проявления пациентов включали лихорадку, непродуктивный кашель, одышку, миалгию, утомляемость, нормальное или пониженное количество лейкоцитов и рентгенологические признаки пневмонии. В тяжелых случаях может наступить дисфункция органов (например, шок, острый респираторный дистресс-синдром [ОРДС], острое повреждение сердца и острое повреждение почек) и смерть. 9 Впоследствии Чен и др. 8 сообщили о результатах 99 случаев NCIP в той же больнице, и результаты показали, что инфекция 2019-nCoV, сгруппированная в группах людей, находящихся в тесном контакте, с большей вероятностью поражала пожилых мужчин с сопутствующими заболеваниями. , и может привести к ОРДС.Однако о различиях в клинических характеристиках тяжелых и нетяжелых случаев не сообщалось. Отчеты о случаях подтвердили передачу NCIP от человека к человеку. 10 , 11 В настоящее время нет эффективных методов лечения или вакцин против NCIP. Цель этой серии случаев состояла в том, чтобы описать клинические характеристики 138 госпитализированных пациентов с NCIP и сравнить тяжелые случаи, которые получали лечение в отделении интенсивной терапии (ICU), с нетяжелыми случаями, которые не получали помощь ICU.

Дизайн исследования и участники

Quiz Ref ID Эта серия случаев была одобрена институциональным советом по этике больницы Чжуннань Уханьского университета (№ 2020020). Были включены все последовательные пациенты с подтвержденным NCIP, госпитализированные в больницу Чжуннань Уханьского университета с 1 по 28 января 2020 г.Устное согласие было получено от пациентов. Больница Чжуннань, расположенная в Ухане, провинция Хубэй, эндемичных районах NCIP, является одной из основных больниц третичного уровня обучения и отвечает за лечение для NCIP, назначенное правительством. Всем пациентам с NCIP, включенным в это исследование, был поставлен диагноз в соответствии с временными рекомендациями Всемирной организации здравоохранения. 12 Клинические исходы (т.е. выписки, смертность, продолжительность пребывания) отслеживались до 3 февраля 2020 г., последней даты наблюдения.

Медицинские карты пациентов были проанализированы исследовательской группой отделения реанимации больницы Чжуннань Уханьского университета. Эпидемиологические, клинические, лабораторные и радиологические характеристики, а также данные о лечении и исходах были получены с помощью форм для сбора данных из электронных медицинских карт. Данные были проанализированы обученной командой врачей. Записанная информация включала демографические данные, историю болезни, историю воздействия, сопутствующие заболевания, симптомы, признаки, лабораторные данные, компьютерную томографию (КТ) грудной клетки и меры лечения (например, противовирусную терапию, кортикостероидную терапию, респираторную поддержку, заместительную почечную терапию).Датой начала заболевания считали день, когда был замечен симптом. Были собраны симптомы, признаки, лабораторные показатели, компьютерная томография грудной клетки и меры лечения во время пребывания в больнице. ОРДС был определен в соответствии с берлинским определением. 13 Острое повреждение почек было идентифицировано в соответствии с определением «Болезнь почек: улучшение глобальных результатов». 14 Поражение сердца определялось, если уровни сердечных биомаркеров (например, тропонина I) в сыворотке крови превышали верхний референсный предел 99-го перцентиля или если при электрокардиографии и эхокардиографии были обнаружены новые аномалии. 9 Для пациентов, поступивших в ОИТ, в день поступления в ОИТ определяли баллы по шкале комы Глазго, оценке последовательной органной недостаточности и оценке острой физиологии и хронического здоровья. Регистрировали продолжительность от начала заболевания до госпитализации, одышки, ОРДС и поступления в ОИТ.

Предполагаемая передача инфекции в больнице подозревалась, если группа медицинских работников или госпитализированных пациентов в одних и тех же палатах заразилась в течение определенного периода времени и возможный источник инфекции можно было отследить.

Анализ полимеразной цепной реакции с обратной транскрипцией в реальном времени для nCoV

Было собрано

образцов мазка из горла для извлечения РНК 2019-nCoV у пациентов с подозрением на инфекцию 2019-nCoV. После сбора мазки из зева помещали в пробирку для сбора с 150 мкл раствора для сохранения вируса, и общую РНК экстрагировали в течение 2 часов с использованием набора для выделения РНК из респираторного образца (Zhongzhi, Wuhan, China).Вкратце, 40 мкл клеточных лизатов переносили в пробирку для сбора с последующим перемешиванием на вортексе в течение 10 секунд. После стояния при комнатной температуре в течение 10 минут пробирку для сбора центрифугировали при 1000 об / мин в течение 5 минут. Суспензию использовали для анализа РНК 2019-nCoV с помощью полимеразной цепной реакции с обратной транскрипцией (ОТ-ПЦР). Два гена-мишени, включая открытую рамку считывания 1ab ( ORF1ab ) и белок нуклеокапсида (N), были одновременно амплифицированы и протестированы в ходе анализа RT-PCR в реальном времени.Мишень 1 ( ORF1ab ): прямой праймер CCCTGTGGGTTTTACACTTAA; обратный праймер ACGATTGTGCATCAGCTGA; и зонд 5'-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3 '. Мишень 2 (N): прямой праймер GGGGAACTTCTCCTGCTAGAAT; обратный праймер CAGACATTTTGCTCTCAAGCTG; и зонд 5'-FAM-TTGCTGCTGCTTGACAGATT-TAMRA-3 '. Анализ ОТ-ПЦР в реальном времени выполняли с использованием набора для обнаружения нуклеиновых кислот 2019-nCoV в соответствии с протоколом производителя (Shanghai bio-germ Medical Technology Co Ltd). Реакционная смесь содержит 12 мкл реакционного буфера, 4 мкл раствора фермента, 4 мкл раствора праймеров для зонда, 3 мкл воды, обработанной диэтилпирокарбонатом, и 2 мкл матрицы РНК.Анализ RT-PCR выполняли в следующих условиях: инкубация при 50 ° C в течение 15 минут и 95 ° C в течение 5 минут, 40 циклов денатурации при 94 ° C в течение 15 секунд, а также расширение и сбор сигнала флуоресценции при 55 ° C в течение 45 секунд. Пороговое значение цикла (значение Ct) менее 37 было определено как положительный результат теста, а значение Ct 40 или более было определено как отрицательный результат теста. Эти диагностические критерии были основаны на рекомендации Национального института по контролю и профилактике вирусных заболеваний (Китай) (http: // ivdc.chinacdc.cn/kyjz/202001/t20200121_211337.html). Средняя нагрузка, определяемая как значение Ct от 37 до менее 40, требовала подтверждения повторным тестированием.

Категориальные переменные были описаны как частота и проценты, а непрерывные переменные были описаны с использованием значений среднего, медианного и межквартильного диапазона (IQR). Средние значения для непрерывных переменных сравнивались с использованием независимых групп t тестов, когда данные были нормально распределены; в противном случае использовали тест Манна-Уитни.Данные (ненормальное распределение) от повторных измерений сравнивались с использованием обобщенной линейной смешанной модели. Пропорции категориальных переменных сравнивались с использованием критерия χ 2 , хотя точный критерий Фишера использовался, когда данные были ограничены. Все статистические анализы были выполнены с использованием программного обеспечения SPSS (Статистический пакет для социальных наук) версии 13.0 (SPSS Inc). Для нескорректированных сравнений двусторонний α менее 0,05 считался статистически значимым. Анализы не корректировались для множественных сравнений, и, учитывая возможность ошибки типа I, результаты следует интерпретировать как исследовательские и описательные.

Представление характеристик

В исследуемую популяцию вошли 138 госпитализированных пациентов с подтвержденным NCIP. Средний возраст составлял 56 лет (IQR, 42-68; диапазон, 22-92 года), и 75 (54,3%) были мужчинами. Из них 102 (73,9%) были помещены в изоляторы, 36 (26.1%) поступили и переведены в ОИТ из-за развития органной дисфункции (таблица 1). Средняя продолжительность от первых симптомов до одышки, госпитализации и ОРДС составляла 5 дней (IQR, 1-10), 7 дней (IQR, 4-8) и 8 дней (IQR, 6-12), соответственно (Таблица 1 ). Из 138 пациентов 64 (46,4%) имели одно или более сопутствующих заболеваний. Гипертония (43 [31,2%]), диабет (14 [10,1%]), сердечно-сосудистые заболевания (20 [14,5%]) и злокачественные новообразования (10 [7,2%]) были наиболее частыми сопутствующими состояниями.

Наиболее частыми симптомами в начале болезни были лихорадка (136 [98,6%]), усталость (96 [69,6%]), сухой кашель (82 [59,4%]), миалгия (48 [34,8%]) и одышка ( 43 [31,2%]). Менее распространенными симптомами были головная боль, головокружение, боль в животе, диарея, тошнота и рвота (Таблица 1). В общей сложности 14 пациентов (10,1%) первоначально поступили с диареей и тошнотой за 1-2 дня до развития лихорадки и одышки.

По сравнению с пациентами, которые не получали помощи в ОИТ (n = 102), пациенты, которым требовалась помощь в ОИТ (n = 36), были значительно старше (средний возраст 66 лет [IQR, 57-78] по сравнению с 51 годом [IQR, 37- 62]; P <.001) и чаще имели сопутствующие заболевания, включая артериальную гипертензию (21 [58,3%] против 22 [21,6%], диабет (8 [22,2%] против 6 [5,9%])), сердечно-сосудистые заболевания (9 [25,0%] против 11 [10,8%]) и цереброваскулярных заболеваний (6 [16,7%] против 1 [1,0%]). По сравнению с пациентами, не получавшими ОИТ, пациенты, поступившие в ОИТ, чаще жаловались на боль в глотке, одышку, головокружение, брюшную полость. боль и анорексия.

Показатели жизнедеятельности и лабораторные параметры у пациентов в отделениях интенсивной терапии и не в отделениях интенсивной терапии

Частота сердечных сокращений, частота дыхания и среднее артериальное давление не различались между пациентами, которые получали помощь в отделении интенсивной терапии, и пациентами, которые не получали помощь в отделении интенсивной терапии.Эти показатели регистрировались в день поступления в больницу для всех пациентов, а затем разделялись на тех, кто позже был помещен в отделение интенсивной терапии или нет. Между пациентами, поступившими в отделение интенсивной терапии, и пациентами, не поступившими в отделение интенсивной терапии, имелись многочисленные различия, включая более высокие уровни лейкоцитов и нейтрофилов, а также более высокие уровни D-димера, креатинкиназы и креатина. Все 138 включенных пациентов показали двустороннее поражение при КТ грудной клетки (рис. 1). Среднее время от появления симптомов до поступления в ОИТ составляло 10 дней (IQR, 6–12) (Таблица 3).В день поступления в ОИТ - медиана шкалы комы Глазго; Острая физиология и оценка хронического здоровья II; и оценка последовательной органной недостаточности составила 15 (IQR, 9-15), 17 (IQR, 10-22) и 5 ​​(IQR, 3-6), соответственно (Таблица 3). Среднее парциальное давление уровня кислорода составляло 68 мм рт. Ст. (IQR, 56–89), а медиана отношения парциального давления кислорода к фракции вдыхаемого кислорода составляла 136 мм рт.

Дисфункции органов и основные вмешательства

Дисфункция органов и лечение 138 пациентов показаны в таблице 4.По состоянию на 3 февраля 2020 года 85 пациентов (61,6%) все еще были госпитализированы. Всего было выписано 47 пациентов (34,1%), 6 пациентов (4,3%) умерли. Из 36 пациентов, поступивших в отделение интенсивной терапии, 11 все еще находились в отделении интенсивной терапии, 9 были выписаны домой, 10 переведены в общие палаты и 6 умерли. Из 11 пациентов, оставшихся в отделении интенсивной терапии, 6 получили инвазивную вентиляцию легких (1 перешел на экстракорпоральную мембранную оксигенацию) и 5 ​​- на неинвазивную вентиляцию легких). Среди 138 пациентов частыми осложнениями были шок (12 [8.7%]), ОРДС (27 [19,6%]), аритмии (23 [16,7%]) и острого сердечного повреждения (10 [7,2%]). Пациенты, которые получали лечение в отделении интенсивной терапии, имели больше шансов иметь одно из этих осложнений, чем пациенты, не находящиеся в отделении интенсивной терапии.

Большинство пациентов получали противовирусную терапию (осельтамивир, 124 [89,9%]), и многие получали антибактериальную терапию (моксифлоксацин, 89 [64,4%]; цефтриаксон, 34 [24,6%]; азитромицин, 25 [18,1%]) и терапию глюкокортикоидами ( 62 [44,9%]). В отделении интенсивной терапии 4 пациента (11,1%) получали высокопоточный кислород, а 15 (44.4%) получали неинвазивную вентиляцию легких. Инвазивная механическая вентиляция легких потребовалась 17 пациентам (47,2%), 4 из которых получали экстракорпоральную мембранную оксигенацию в качестве неотложной терапии. В общей сложности 13 пациентов получали вазопрессоры, а 2 пациента получали заместительную почечную терапию.

Динамический профиль лабораторных данных у пациентов с NCIP

Для определения основных клинических признаков, которые проявлялись во время прогрессирования NCIP, динамические изменения 6 клинических лабораторных параметров, включая гематологические и биохимические параметры, отслеживались с 1 по 19 день после начала заболевания с двухдневными интервалами.В конце 28 января 2020 г. были проанализированы данные 33 пациентов с полным клиническим течением (рис. 2). Во время госпитализации у большинства пациентов наблюдалась выраженная лимфопения, а у не выживших со временем развивалась более тяжелая лимфопения. Количество лейкоцитов и нейтрофилов у не выживших было выше, чем у выживших. Уровень D-димера был выше у выживших, чем у выживших. Точно так же по мере прогрессирования заболевания и ухудшения клинического статуса уровни мочевины и креатинина в крови прогрессивно повышались перед смертью.

Предполагаемая передача и инфекция в больнице

Из 138 пациентов 57 (41,3%) предположительно были инфицированы в больнице, в том числе 17 пациентов (12,3%), которые уже были госпитализированы по другим причинам, и 40 медицинских работников (29%). Из госпитализированных пациентов 7 пациентов были из хирургического отделения, 5 - из терапевтического и 5 - из онкологического.Из инфицированных медицинских работников 31 (77,5%) работали в палатах общего профиля, 7 (17,5%) - в отделении неотложной помощи и 2 (5%) - в отделении интенсивной терапии. У одного пациента в текущем исследовании появились абдоминальные симптомы, и он был госпитализирован в хирургическое отделение. Предположительно, более 10 медицинских работников этого отделения заразились этим пациентом. Также предполагалось, что произошла передача инфекции от пациента к пациенту, и по крайней мере 4 госпитализированных пациента в одной палате были инфицированы, и все они имели атипичные абдоминальные симптомы.У одного из 4 пациентов была лихорадка, и во время госпитализации у него была диагностирована инфекция nCoV. Затем пациент был изолирован. Впоследствии у других 3 пациентов в том же отделении поднялась температура, появились абдоминальные симптомы, и им был поставлен диагноз инфекции nCoV.

Quiz Ref ID Этот отчет, насколько нам известно, представляет собой самую крупную на сегодняшний день серию случаев госпитализированных пациентов с NCIP. По состоянию на 3 февраля 2020 года из 138 пациентов, включенных в это исследование, 26% нуждались в отделении интенсивной терапии, 34.1% были выписаны, 6 умерли (4,3%), 61,6% остаются госпитализированными. Для выписанных (n = 47) пребывание в стационаре составило 10 дней (IQR, 7,0–14,0). Время от появления одышки составляло 5,0 дней, 7,0 дней до госпитализации и 8,0 дней до ОРДС. Обычными симптомами в начале болезни были лихорадка, сухой кашель, миалгия, утомляемость, одышка и анорексия. Однако у значительной части пациентов изначально наблюдались атипичные симптомы, такие как диарея и тошнота. Основные осложнения во время госпитализации включали ОРДС, аритмию и шок.Двустороннее распределение пятнистых теней и непрозрачность матового стекла были типичным признаком компьютерной томографии для NCIP. Большинство пациентов в критическом состоянии были старше и имели больше сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Большинству пациентов требовалась кислородная терапия, а меньшинство пациентов нуждались в инвазивной вентиляции или даже экстракорпоральной мембранной оксигенации.

Quiz Ref ID Данные этого исследования свидетельствуют о возможности быстрой передачи вируса 2019-nCoV от человека к человеку. Основная причина заключается в оценке основного репродуктивного числа (R 0 ) на основе предыдущего исследования. 15 R 0 указывает, насколько заразно инфекционное заболевание. Когда инфекция распространяется среди новых людей, она воспроизводится; R 0 указывает на среднее число дополнительных лиц, которых заражает один больной в течение его болезни, и конкретно относится к группе людей, которые ранее не были инфицированы и не были вакцинированы. Согласно отчету, R 0 от nCoV составляет 2,2, что свидетельствует о том, что в среднем каждый пациент распространял инфекцию на 2.2 других человека. 15 Одна из причин быстрого распространения может быть связана с нетипичными симптомами на ранней стадии у некоторых пациентов, инфицированных nCoV.

Недавнее исследование показало, что нКоВ был обнаружен в образцах стула пациентов с абдоминальными симптомами. 16 Однако трудно дифференцировать и обследовать пациентов с атипичными симптомами. Тем не менее, быстрая передача от человека к человеку среди близких контактов является важной особенностью пневмонии nCoV. 10 , 11,15

Пациенты, поступившие в отделение интенсивной терапии, были старше и имели большее количество сопутствующих заболеваний, чем пациенты, не госпитализированные в отделение интенсивной терапии. Это говорит о том, что возраст и сопутствующие заболевания могут быть факторами риска неблагоприятного исхода. Однако не было никакой разницы в доле мужчин и женщин между пациентами ОИТ и пациентами, не получавшими ОИТ. Эти данные отличаются от недавнего отчета, который показал, что инфекция 2019-nCoV чаще поражает мужчин. 8 Возможное объяснение состоит в том, что инфекция nCoV у пациентов в предыдущем отчете была связана с воздействием, связанным с оптовым рынком морепродуктов Хуанань, и большинство пострадавших пациентов были работниками-мужчинами.По сравнению с симптомами у пациентов, не находящихся в отделении интенсивной терапии, симптомы чаще встречались у пациентов в критическом состоянии, включая одышку, боль в животе и анорексию. Появление симптомов может помочь врачам определить пациентов с плохим прогнозом. В этой когорте общие показатели тяжелой гипоксии и инвазивной вентиляции были выше, чем в предыдущем исследовании, 9 , вероятно, потому что случаи в предыдущем исследовании относились к ранней эпидемической стадии NCIP, а текущие случаи - из стадия вспышки.

Наиболее частыми лабораторными отклонениями, наблюдаемыми в этом исследовании, были пониженное количество лимфоцитов, увеличенное протромбиновое время и повышенная лактатдегидрогеназа. По сравнению с пациентами, не находящимися в отделении интенсивной терапии, пациенты, получавшие помощь в отделении интенсивной терапии, имели многочисленные лабораторные отклонения. Эти отклонения предполагают, что инфекция 2019-nCoV может быть связана с клеточным иммунодефицитом, активацией коагуляции, повреждением миокарда, повреждением печени и почек. Эти лабораторные отклонения аналогичны тем, которые ранее наблюдались у пациентов с инфекцией БВРС-КоВ и ТОРС-КоВ.

Динамический профиль лабораторных данных отслеживался у 33 пациентов с NCIP (5 выживших и 28 выживших). У не выживших количество нейтрофилов, D-димер, уровни мочевины в крови и креатинина продолжали расти, а количество лимфоцитов продолжало снижаться до наступления смерти. Нейтрофилия может быть связана с цитокиновым штормом, вызванным вирусной инвазией, активация коагуляции могла быть связана с устойчивым воспалительным ответом, а острое повреждение почек могло быть связано с прямым воздействием вируса, гипоксией и шоком.Три патологических механизма могут быть связаны со смертью пациентов с NCIP.

Quiz Ref ID До настоящего времени не рекомендовалось никакого специального лечения коронавирусной инфекции, кроме тщательной поддерживающей терапии. 17 В настоящее время подход к этой болезни заключается в борьбе с источником инфекции; использование средств индивидуальной защиты для снижения риска передачи; и ранняя диагностика, изоляция и поддерживающее лечение пораженных пациентов. Антибактериальные средства неэффективны.Кроме того, не было обнаружено, что противовирусные агенты приносят пользу при лечении SARS и MERS. Все пациенты в этом исследовании получали антибактериальные препараты, 90% получали противовирусную терапию и 45% получали метилпреднизолон. Доза осельтамивира и метилпреднизолона варьировалась в зависимости от тяжести заболевания. Однако никаких эффективных результатов не наблюдалось.

Это исследование имеет несколько ограничений. Во-первых, образцы дыхательных путей были использованы для диагностики NCIP с помощью RT-PCR.Сыворотка пациентов для оценки виремии не бралась. Вирусная нагрузка является потенциально полезным маркером, связанным с тяжестью заболевания коронавирусной инфекцией, и ее следует определять в NCIP. Во-вторых, передачу / инфекцию в больницах нельзя было окончательно доказать, но это предполагалось и предполагалось на основании времени и характера контакта с инфицированными пациентами и последующего развития инфекции. В-третьих, из 138 случаев большинство пациентов все еще госпитализированы на момент подачи рукописи.Следовательно, трудно оценить факторы риска неблагоприятного исхода, и необходимы постоянные наблюдения за естественным течением болезни.

В этой одноцентровой серии случаев из 138 госпитализированных пациентов с подтвержденным NCIP в Ухане, Китай, предполагаемая госпитальная передача 2019-nCoV подозревалась у 41% пациентов, 26% пациентов получали помощь в отделении интенсивной терапии, а смертность составила 4,3%. .

Авторы, отвечающие за переписку: Чжиюн Пэн, доктор медицины, отделение интенсивной терапии (pengzy5 @ hotmail.com) и Синхуан Ван, доктор медицины, отделение урологии ([email protected]), больница Чжуннань Уханьского университета, Ухань 430071, Хубэй, Китай.

Принято к публикации: 3 февраля 2020 г.

Опубликовано в Интернете: 7 февраля 2020 г. doi: 10.1001 / jama.2020.1585

Исправление: Эта статья была исправлена ​​20 февраля 2020 г., чтобы добавить правильные данные для пациенток в Таблице 1.

Вклад авторов: Доктор Д.Ван и Пэн имели полный доступ ко всем данным в исследовании и несли ответственность за целостность данных и точность анализа данных. Доктора Д. Ван и Б. Ху внесли равный вклад и имеют первое авторство. Доктора Пэн и X. Ван внесли равный вклад в эту статью.

Концепция и дизайн: D. Wang, B. Hu, C. Hu, Xiong, Zhao, Li, X. Wang, Peng.

Сбор, анализ или интерпретация данных: Д. Ван, К. Ху, Чжу, Лю, Чжан, Б. Ван, Сян, Чэн, Сюн, Пэн.

Составление рукописи: Д. Ван, К. Ху, Сян, Сюн, Ли, Пэн.

Критический пересмотр рукописи на предмет важного интеллектуального содержания: Д. Ван, Б. Ху, Чжу, Лю, Чжан, Б. Ван, Чэн, Сюн, Чжао, X. Ван, Пэн.

Статистический анализ: К. Ху, Чжу, Лю, Б. Ван, Сюн.

Получено финансирование: Д. Ван, Пэн.

Административная, техническая или материальная поддержка: B. Hu, Xiang, Cheng, Xiong, Li, X.Ван.

Наблюдение: Б. Ху, Сюн, Чжао, X. Ван, Пэн.

Раскрытие информации о конфликте интересов: Не сообщалось.

Финансирование / поддержка: Эта работа была поддержана Национальным фондом естественных наук (грант 81701941 доктору Д. Вангу; гранты 81772046 и 81971816 доктору Пэну) и Специальным проектом по значительным исследованиям и разработкам новых лекарственных средств в крупном национальном масштабе. Научно-технические проекты Китая (2020ZX09201007 доктору Пэну).

Роль спонсора / спонсора: Спонсоры не играли никакой роли в разработке и проведении исследования; сбор, управление, анализ и интерпретация данных; подготовка, рецензирование или утверждение рукописи; и решение представить рукопись для публикации.

1.Lu H, Страттон CW, Тан YW. Вспышка пневмонии неизвестной этиологии в Ухане, Китай: тайна и чудо [опубликовано 16 января 2020 г.]. J Med Virol . 2020. doi: 10.1002 / jmv.25678PubMedGoogle Scholar2.Hui DS, я Азхар Э, Мадани TA, и другие. Сохраняющаяся угроза эпидемии нового коронавируса 2019-nCoV для глобального здравоохранения: последняя вспышка нового коронавируса 2019 года в Ухане, Китай [опубликовано 14 января 2020 г.]. Int J Infect Dis . 2020; 91: 264-266. DOI: 10.1016 / j.ijid.2020.01.009PubMedGoogle ScholarCrossref 7.Zhu Н, Чжан Д, Ван W, и другие; Китайская группа по расследованию и исследованию нового коронавируса.Новый коронавирус от пациентов с пневмонией в Китае, 2019 г. [опубликовано 24 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMoa2001017PubMedGoogle Scholar8.Chen Н, Чжоу М, Донг ИКС, и другие. Эпидемиологические и клинические характеристики 99 случаев новой коронавирусной пневмонии 2019 г. в Ухане, Китай: описательное исследование [опубликовано 29 января 2020 г.]. Ланцет . DOI: 10.1016 / S0140-6736 (20) 30211-7PubMedGoogle Scholar10.Chan JF-W, юань S, Кок К-Х, и другие.Семейный кластер пневмонии, связанный с новым коронавирусом 2019 года, указывающий на передачу от человека к человеку: исследование семейного кластера [опубликовано 24 января 2020 года]. Ланцет . 2020; S0140-6736 (20) 30154-9. DOI: 10.1016 / S0140-6736 (20) 30154-9PubMedGoogle Scholar11.Phan LT, Нгуен ТВ, Луонг QC, и другие. Ввоз и передача от человека к человеку нового коронавируса во Вьетнаме [опубликовано 28 января 2020 г.]. N Engl J Med . DOI: 10.1056 / NEJMc2001272PubMedGoogle Scholar13.Ranieri В.М., Рубенфельд GD, Томпсон BT, и другие; Рабочая группа по определению ARDS. Синдром острого респираторного дистресса: берлинское определение. JAMA . 2012; 307 (23): 2526-2533. DOI: 10.1001 / jama.2012.5669PubMedGoogle Scholar 14. Заболевание почек: улучшение глобальных результатов (KDIGO) Рабочая группа по острой травме почек. Руководство KDIGO по клинической практике при острой травме почек. Почки Int Suppl . 2012; 2: 1.Google ScholarCrossref 15.Ли Q, Гуань X, Wu П, и другие. динамика ранней передачи новой пневмонии, инфицированной коронавирусом, в Ухане, Китай. [опубликовано 29 января 2020 г.]. N Engl J Med . 2020. doi: 10.1056 / NEJMoa2001316PubMedGoogle Scholar16.Zhang H, Кан ZJ, Гонг Привет, и другие. Пищеварительная система - потенциальный путь заражения нКоВ 2019: биоинформатический анализ, основанный на одноклеточных транскриптомах. Препринт. Опубликовано 31 января 2020 г.bioRxiv 927806. DOI: 10.1101 / 2020.01.30.927806 .
Разное

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *